RchiOBHm_Chr5g0042861

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
37678344 .. 37680688
2345 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32123

Sequence Viewer

Length: 144 bp
ATGCATCGTTTGGTTACCCTGGTGGTTATCCTGTGGAAAACTAAAGTTATCTCGAAGAAAGTAGTGATTGCACTTGGCAAGAGTGTAGCTGGAAATATCAAAGAGTTGGAGCTGAACAAGGAACCATGGGTAACAAGATGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

47

Amino Acids

5.34

Weight (kDa)

10.14

Isoelectric Point (pI)

34.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 18
AluBI AGCT 2 cut(s) 89, 112
AluI AGCT 2 cut(s) 89, 112
BciT130I CCWGG 1 cut(s) 20
Bme1390I CCNGG 1 cut(s) 20
BmiI GGNNCC 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 20
BmsI GCATC 2 cut(s) 13, 128
BsaJI CCNNGG 2 cut(s) 18, 125
BseBI CCWGG 1 cut(s) 20
BseDI CCNNGG 2 cut(s) 18, 125
Bsp19I CCATGG 1 cut(s) 125
BspLI GGNNCC 1 cut(s) 123
BssECI CCNNGG 2 cut(s) 18, 125
BssT1I CCWWGG 1 cut(s) 125
Bst2UI CCWGG 1 cut(s) 20
BstDSI CCRYGG 1 cut(s) 125
BstEII GGTNACC 1 cut(s) 13
BstNI CCWGG 1 cut(s) 20
BstPI GGTNACC 1 cut(s) 13
BstSCI CCNGG 1 cut(s) 18
BtgI CCRYGG 1 cut(s) 125
CviAII CATG 1 cut(s) 126
CviJI RGCY 2 cut(s) 89, 112
CviKI_1 RGCY 2 cut(s) 89, 112
Eco130I CCWWGG 1 cut(s) 125
Eco91I GGTNACC 1 cut(s) 13
EcoO65I GGTNACC 1 cut(s) 13
EcoRII CCWGG 1 cut(s) 18
EcoT14I CCWWGG 1 cut(s) 125
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 125
FaeI CATG 1 cut(s) 129
FaiI YATR 1 cut(s) 127
FatI CATG 1 cut(s) 125
Hin1II CATG 1 cut(s) 129
Hpy188III TCNNGA 1 cut(s) 52
HpyCH4V TGCA 2 cut(s) 4, 71
Hsp92II CATG 1 cut(s) 129
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 4 cut(s) 5, 32, 44, 75
LweI GCATC 2 cut(s) 13, 128
MaeIII GTNAC 2 cut(s) 13, 130
MboII GAAGA 1 cut(s) 67
MmeI TCCRAC 1 cut(s) 87
Mph1103I ATGCAT 1 cut(s) 6
MspR9I CCNGG 1 cut(s) 20
MvaI CCWGG 1 cut(s) 20
NcoI CCATGG 1 cut(s) 125
NlaIII CATG 1 cut(s) 129
NlaIV GGNNCC 1 cut(s) 123
NsiI ATGCAT 1 cut(s) 6
Psp6I CCWGG 1 cut(s) 18
PspEI GGTNACC 1 cut(s) 13
PspGI CCWGG 1 cut(s) 18
PspN4I GGNNCC 1 cut(s) 123
ScrFI CCNGG 1 cut(s) 20
SetI ASST 2 cut(s) 91, 114
SfaNI GCATC 2 cut(s) 13, 128
SgeI CNNG 9 cut(s) 31, 32, 43, 64, 86, 91, 102, 130, 138
StyD4I CCNGG 1 cut(s) 18
StyI CCWWGG 1 cut(s) 125
TaqI TCGA 1 cut(s) 53
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.