RchiOBHm_Chr5g0009181

Ribonucleoside-diphosphate reductase small chain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
6114061 .. 6114457
397 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29009

Sequence Viewer

Length: 168 bp
ATGATTCTAGGTGTACAGAGAAACAATAACAGTACTGATTTTGAAAGCCTGGTTTGTGTCTGTGCTAAGGAGGTTGATGTCTCCCAAGATGTACAGCAGTGGGAGGCTCTGACTGACTCCAAGAAACACTTTATCAGTCATGTCCCGGCATTTTTGAGGCAAAGGTAA

Protein Analysis

55

Amino Acids

6.32

Weight (kDa)

6.01

Isoelectric Point (pI)

39.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribonuc_red_sm PF00268 22 - 53 1.8e-06 Ribonucleotide reductase, small chain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 3 cut(s) 15, 34, 93
AgsI TTSAA 1 cut(s) 44
AjnI CCWGG 1 cut(s) 48
Alw26I GTCTC 1 cut(s) 85
AsuC2I CCSGG 1 cut(s) 146
BciT130I CCWGG 1 cut(s) 50
BcnI CCSGG 1 cut(s) 146
BcoDI GTCTC 1 cut(s) 85
BfaI CTAG 1 cut(s) 8
BmcAI AGTACT 1 cut(s) 34
Bme1390I CCNGG 2 cut(s) 50, 146
BmrFI CCNGG 2 cut(s) 50, 146
Bpu10I CCTNAGC 1 cut(s) 66
BpuMI CCSGG 1 cut(s) 146
BseBI CCWGG 1 cut(s) 50
BsiSI CCGG 1 cut(s) 146
BslFI GGGAC 1 cut(s) 128
BsmAI GTCTC 1 cut(s) 85
BsmFI GGGAC 1 cut(s) 128
Bsp1407I TGTACA 2 cut(s) 13, 91
BsrGI TGTACA 2 cut(s) 13, 91
Bst2UI CCWGG 1 cut(s) 50
Bst4CI ACNGT 1 cut(s) 32
BstAUI TGTACA 2 cut(s) 13, 91
BstDEI CTNAG 1 cut(s) 66
BstMAI GTCTC 1 cut(s) 85
BstNI CCWGG 1 cut(s) 50
BstSCI CCNGG 2 cut(s) 48, 144
BtsI GCAGTG 1 cut(s) 104
BtsIMutI CAGTG 1 cut(s) 104
Csp6I GTAC 3 cut(s) 14, 33, 92
CviAII CATG 1 cut(s) 140
CviJI RGCY 2 cut(s) 48, 107
CviKI_1 RGCY 2 cut(s) 48, 107
CviQI GTAC 3 cut(s) 14, 33, 92
DdeI CTNAG 1 cut(s) 66
EcoRII CCWGG 1 cut(s) 48
FaeI CATG 1 cut(s) 143
FaiI YATR 1 cut(s) 141
FalI AAGNNNNNCTT 2 cut(s) 113, 145
FaqI GGGAC 1 cut(s) 128
FatI CATG 1 cut(s) 139
FspBI CTAG 1 cut(s) 8
HapII CCGG 1 cut(s) 146
Hin1II CATG 1 cut(s) 143
HinfI GANTC 2 cut(s) 4, 116
HpaII CCGG 1 cut(s) 146
Hpy166II GTNNAC 1 cut(s) 14
Hpy188I TCNGA 1 cut(s) 111
Hpy8I GTNNAC 1 cut(s) 14
HpyCH4III ACNGT 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 66
Hsp92II CATG 1 cut(s) 143
LpnPI CCDG 3 cut(s) 35, 62, 159
MaeI CTAG 1 cut(s) 8
MlyI GAGTC 1 cut(s) 110
MnlI CCTC 3 cut(s) 64, 97, 150
MspI CCGG 1 cut(s) 146
MspR9I CCNGG 2 cut(s) 50, 146
MvaI CCWGG 1 cut(s) 50
NciI CCSGG 1 cut(s) 146
NlaIII CATG 1 cut(s) 143
PfeI GAWTC 1 cut(s) 4
PleI GAGTC 1 cut(s) 110
PpsI GAGTC 1 cut(s) 110
Psp6I CCWGG 1 cut(s) 48
PspGI CCWGG 1 cut(s) 48
RsaI GTAC 3 cut(s) 15, 34, 93
RsaNI GTAC 3 cut(s) 14, 33, 92
ScaI AGTACT 1 cut(s) 34
SchI GAGTC 1 cut(s) 110
ScrFI CCNGG 2 cut(s) 50, 146
SetI ASST 3 cut(s) 13, 75, 167
SgeI CNNG 8 cut(s) 20, 61, 62, 98, 133, 152, 157, 158
SspMI CTAG 1 cut(s) 8
StyD4I CCNGG 2 cut(s) 48, 144
TaaI ACNGT 1 cut(s) 32
TatI WGTACW 3 cut(s) 13, 32, 91
TfiI GAWTC 1 cut(s) 4
TscAI CASTG 1 cut(s) 104
TspRI CASTG 1 cut(s) 104
XspI CTAG 1 cut(s) 8
ZrmI AGTACT 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.