RCHIOBHM_CHR0C40G0503401

No description available

Design Primers CRISPR Design

Basic Information

Type: Sequence Only
Biological Identity
rosa_chinensis
Unknown
OG0002057
Physical Location & Seq
Reverse (-)
0 .. 0
1 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 588 bp
ATGAAGCGCAGATCTTTGAAAGCTCAGAATTTGGCAGGAACACTCCCACCAGAGTTGAAGAGGCTCACCTATCTACAAACAATTTCCCTTGTTGGAAACCGTTTGACAGGTTCTATCCCCATTGAGATCGGAAACATTAGCACCCTGCAAAGTTTGGACATCACTTCCAATAATTTTTCAGGACTTCCTCCGGAGCTTGGGAATTTAACCAGCATAAAGAAAATGCTTCTTTCCTCAAACAATTTTACTGGGAAGTTGCCCGAAACATTTGCAAGGCTTAAGACATTAACGGACTTTCGGGTTGATGACAATCACTTTTCTGGGAAGATACCTGATTTCATTCAGAACTGGACAAATCTTACAAAACTAGTAATTCAGGCTAGTGGTTTGACTGGGCCAATTCCATCCAGCATCTCTCTTTTGAAGGAATTAACTGACCTGATGTTGAGGAATTGCAATCTTACTGGAGAACTACCTATGAATCTTGCAGATATGACAAAGTTGAAATACTTAGACCTCAGCTTTAACAAGCTTACTGGGGAAATTCCAAGCTCCTTTGGTAATGAAAATGATTTGGATTACATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

195

Amino Acids

21.59

Weight (kDa)

8.66

Isoelectric Point (pI)

32.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 190
AcsI RAATTY 3 cut(s) 28, 202, 543
AfiI CCNNNNNNNGG 1 cut(s) 197
AflII CTTAAG 1 cut(s) 278
AflIII ACRYGT 1 cut(s) 582
AgsI TTSAA 4 cut(s) 19, 58, 424, 505
AhlI ACTAGT 1 cut(s) 367
AluBI AGCT 5 cut(s) 23, 196, 522, 532, 552
AluI AGCT 5 cut(s) 23, 196, 522, 532, 552
Aor13HI TCCGGA 1 cut(s) 190
AoxI GGCC 1 cut(s) 395
ApoI RAATTY 3 cut(s) 28, 202, 543
AspLEI GCGC 1 cut(s) 9
AspS9I GGNCC 1 cut(s) 395
AsuHPI GGTGA 1 cut(s) 58
BbvCI CCTCAGC 1 cut(s) 518
BccI CCATC 1 cut(s) 412
BcgI CGANNNNNNTGC 2 cut(s) 251, 285
BcuI ACTAGT 1 cut(s) 367
BfaI CTAG 2 cut(s) 368, 381
BfrI CTTAAG 1 cut(s) 278
BglII AGATCT 1 cut(s) 11
BmgT120I GGNCC 1 cut(s) 395
BmrI ACTGGG 3 cut(s) 258, 402, 546
BmsI GCATC 1 cut(s) 420
BmuI ACTGGG 3 cut(s) 258, 402, 546
BpmI CTGGAG 1 cut(s) 486
Bpu10I CCTNAGC 1 cut(s) 518
BsaBI GATNNNNATC 1 cut(s) 309
BsaWI WCCGGW 1 cut(s) 190
Bsc4I CCNNNNNNNGG 1 cut(s) 197
Bse1I ACTGG 5 cut(s) 253, 353, 397, 469, 541
Bse8I GATNNNNATC 1 cut(s) 309
BseAI TCCGGA 1 cut(s) 190
BseGI GGATG 1 cut(s) 404
BseJI GATNNNNATC 1 cut(s) 309
BseLI CCNNNNNNNGG 1 cut(s) 197
BseMII CTCAG 2 cut(s) 38, 532
BseNI ACTGG 5 cut(s) 253, 353, 397, 469, 541
BshFI GGCC 1 cut(s) 397
BsiSI CCGG 1 cut(s) 191
BslI CCNNNNNNNGG 1 cut(s) 197
BsnI GGCC 1 cut(s) 397
Bsp13I TCCGGA 1 cut(s) 190
Bsp143I GATC 2 cut(s) 11, 126
BspANI GGCC 1 cut(s) 397
BspCNI CTCAG 2 cut(s) 37, 531
BspEI TCCGGA 1 cut(s) 190
BspTI CTTAAG 1 cut(s) 278
BsrI ACTGG 5 cut(s) 253, 353, 397, 469, 541
BssMI GATC 2 cut(s) 11, 126
Bst4CI ACNGT 1 cut(s) 101
Bst6I CTCTTC 1 cut(s) 53
BstAFI CTTAAG 1 cut(s) 278
BstDEI CTNAG 3 cut(s) 24, 511, 518
BstF5I GGATG 1 cut(s) 404
BstHHI GCGC 1 cut(s) 9
BstKTI GATC 2 cut(s) 14, 129
BstMBI GATC 2 cut(s) 11, 126
BstNSI RCATGY 1 cut(s) 586
BstX2I RGATCY 1 cut(s) 11
BstYI RGATCY 1 cut(s) 11
BsuRI GGCC 1 cut(s) 397
BtsCI GGATG 1 cut(s) 404
CfoI GCGC 1 cut(s) 9
Cfr13I GGNCC 1 cut(s) 395
CspCI CAANNNNNGTGG 2 cut(s) 36, 71
CviAII CATG 1 cut(s) 583
CviJI RGCY 9 cut(s) 23, 64, 196, 277, 380, 397, 522, 532, 552
CviKI_1 RGCY 9 cut(s) 23, 64, 196, 277, 380, 397, 522, 532, 552
DdeI CTNAG 3 cut(s) 24, 511, 518
DpnI GATC 2 cut(s) 13, 128
DpnII GATC 2 cut(s) 11, 126
Eam1104I CTCTTC 1 cut(s) 53
EarI CTCTTC 1 cut(s) 53
FaeI CATG 1 cut(s) 586
FaiI YATR 4 cut(s) 215, 479, 494, 584
FatI CATG 1 cut(s) 582
FokI GGATG 1 cut(s) 391
FspBI CTAG 2 cut(s) 368, 381
GlaI GCGC 1 cut(s) 8
GsuI CTGGAG 1 cut(s) 486
HaeIII GGCC 1 cut(s) 397
HapII CCGG 1 cut(s) 191
HhaI GCGC 1 cut(s) 9
Hin1II CATG 1 cut(s) 586
Hin6I GCGC 1 cut(s) 7
HinP1I GCGC 1 cut(s) 7
HindIII AAGCTT 1 cut(s) 530
HinfI GANTC 1 cut(s) 481
HpaII CCGG 1 cut(s) 191
HphI GGTGA 1 cut(s) 58
Hpy188I TCNGA 3 cut(s) 27, 131, 345
Hpy188III TCNNGA 2 cut(s) 180, 191
HpyAV CCTTC 1 cut(s) 418
HpyCH4III ACNGT 1 cut(s) 101
HpyCH4V TGCA 4 cut(s) 148, 272, 456, 488
HpyF3I CTNAG 3 cut(s) 24, 511, 518
Hsp92II CATG 1 cut(s) 586
HspAI GCGC 1 cut(s) 7
Kpn2I TCCGGA 1 cut(s) 190
Kzo9I GATC 2 cut(s) 11, 126
LmnI GCTCC 2 cut(s) 193, 557
LweI GCATC 1 cut(s) 420
MaeI CTAG 2 cut(s) 368, 381
MalI GATC 2 cut(s) 13, 128
MboI GATC 2 cut(s) 11, 126
MboII GAAGA 2 cut(s) 70, 337
MflI RGATCY 1 cut(s) 11
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 5 cut(s) 54, 198, 244, 441, 527
MroI TCCGGA 1 cut(s) 190
MseI TTAA 5 cut(s) 206, 279, 287, 431, 525
MspCI CTTAAG 1 cut(s) 278
MspI CCGG 1 cut(s) 191
NdeII GATC 2 cut(s) 11, 126
NlaIII CATG 1 cut(s) 586
NspI RCATGY 1 cut(s) 586
PciI ACATGT 1 cut(s) 582
PfeI GAWTC 1 cut(s) 481
PscI ACATGT 1 cut(s) 582
PspPI GGNCC 1 cut(s) 395
PsuI RGATCY 1 cut(s) 11
SaqAI TTAA 5 cut(s) 206, 279, 287, 431, 525
Sau3AI GATC 2 cut(s) 11, 126
Sau96I GGNCC 1 cut(s) 395
SfaNI GCATC 1 cut(s) 420
SmlI CTYRAG 1 cut(s) 278
SmoI CTYRAG 1 cut(s) 278
SpeI ACTAGT 1 cut(s) 367
SspMI CTAG 2 cut(s) 368, 381
TaaI ACNGT 1 cut(s) 101
TfiI GAWTC 1 cut(s) 481
Tru1I TTAA 5 cut(s) 206, 279, 287, 431, 525
Tru9I TTAA 5 cut(s) 206, 279, 287, 431, 525
TspDTI ATGAA 4 cut(s) 17, 328, 494, 579
TspGWI ACGGA 1 cut(s) 305
Vha464I CTTAAG 1 cut(s) 278
XapI RAATTY 3 cut(s) 28, 202, 543
XceI RCATGY 1 cut(s) 586
XspI CTAG 2 cut(s) 368, 381
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.