RchiOBHm_Chr2g0112811

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
24869930 .. 24872665
2736 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48623

Sequence Viewer

Length: 945 bp
ATGCTCATGTCAATGTTGGTAGGGTGTGATCTAATGAGATATATTGATGGGTCTATCCCTTGTCCTTCACGATACAAAGTTGCACAAGAGGCTGGAATTACCCCTGAGCTTACACAAGAGTATAAGGACTGGAGGAAGCATGACTCTGCTGTAATGGCTCTACTAGCTGGTACTTTGTCATCTTCAGCTCTTTCATTCATTGTTGGGAGTAAAATCTCAAAAGAAGTTTGGTATTCCCTTGAAGATAGATATGCTAAACTTTCAAAGTTCAAAGCTTTTGAGCTAAAGACCTCCATGCAGAAAATCCAGAAAGGTAATGATAGTATTGACAAGTATATGGAACGCTTTAAAACTGTTCGGGACCAACTCTTTATAGCTGGAATTCTTATTTCTGATGATGAAATAGTGAGTTTGATCTTGAATGGGCTACCTGCTGAATATGCAACTATCAGATTGATCATTCGTACTAAGGAATCATCTACATCTCTACCAAAACTTCGTACACTACTCTTAGATGTCGAAGCTGATCTTGAAAGAGAACAAAAGATTATTACCTCTGCTCCAATTACTTTAACAGCTACAAGAAACCAAGACTCTCTTGATCAAGAACAAAAGATCATTGCCTCTTCTCCAATGACTTTAACAGGTACAAGAAACCAAGACTGTCAGCTTTCTAAATCTCATCATATCTGTGCACATACTCAAGGATTATACAACTTGGTTCTCACAAGATATTTTCATCCAAGGAATCAAGGTGAAGGTGGTGGCAGGTACTATCATAAATTTTCTCATGGACCATATCGAAATTATAATTGCTATGCATATAGGAAGTTAGATGTTGGTTCTCGGCAATCTAGGGGATTTATTAATCATTGTGGAAACTCAAAGTGCTACAACACTGATGGTATTTCCAACAATCTTGGCTTTGTGAAGTCCAAAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

314

Amino Acids

35.55

Weight (kDa)

9.08

Isoelectric Point (pI)

27.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_2 PF14223 28 - 180 3.3e-20 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 810
Acc36I ACCTGC 2 cut(s) 439, 759
AcsI RAATTY 2 cut(s) 381, 782
AcuI CTGAAG 1 cut(s) 168
AfaI GTAC 5 cut(s) 172, 466, 502, 649, 773
AgsI TTSAA 5 cut(s) 242, 264, 271, 421, 533
AluBI AGCT 9 cut(s) 109, 167, 188, 275, 283, 377, 524, 578, 670
AluI AGCT 9 cut(s) 109, 167, 188, 275, 283, 377, 524, 578, 670
Alw21I GWGCWC 1 cut(s) 697
Alw44I GTGCAC 1 cut(s) 693
ApaLI GTGCAC 1 cut(s) 693
ApoI RAATTY 2 cut(s) 381, 782
AseI ATTAAT 1 cut(s) 867
AspS9I GGNCC 2 cut(s) 361, 794
AsuHPI GGTGA 1 cut(s) 767
AvaII GGWCC 2 cut(s) 361, 794
BaeGI GKGCMC 1 cut(s) 697
Bbv12I GWGCWC 1 cut(s) 697
BccI CCATC 2 cut(s) 41, 896
BclI TGATCA 2 cut(s) 456, 601
BfaI CTAG 3 cut(s) 164, 855, 943
BfuAI ACCTGC 2 cut(s) 439, 759
Bme18I GGWCC 2 cut(s) 361, 794
BmgT120I GGNCC 2 cut(s) 361, 794
BmiI GGNNCC 1 cut(s) 362
BpmI CTGGAG 1 cut(s) 151
Bpu10I CCTNAGC 1 cut(s) 105
BpuEI CTTGAG 1 cut(s) 687
BsaJI CCNNGG 1 cut(s) 743
BsaXI ACNNNNNCTCC 2 cut(s) 544, 574
Bse1I ACTGG 1 cut(s) 134
Bse3DI GCAATG 1 cut(s) 618
BseDI CCNNGG 1 cut(s) 743
BseGI GGATG 1 cut(s) 739
BseMI GCAATG 1 cut(s) 618
BseMII CTCAG 1 cut(s) 96
BseNI ACTGG 1 cut(s) 134
BseSI GKGCMC 1 cut(s) 697
BsiHKAI GWGCWC 1 cut(s) 697
BslFI GGGAC 1 cut(s) 374
BsmFI GGGAC 1 cut(s) 374
Bsp1286I GDGCHC 1 cut(s) 697
Bsp143I GATC 6 cut(s) 28, 414, 456, 526, 601, 615
BspCNI CTCAG 1 cut(s) 97
BspLI GGNNCC 1 cut(s) 362
BspMI ACCTGC 2 cut(s) 439, 759
BsrDI GCAATG 1 cut(s) 618
BsrI ACTGG 1 cut(s) 134
BssECI CCNNGG 1 cut(s) 743
BssMI GATC 6 cut(s) 28, 414, 456, 526, 601, 615
BssT1I CCWWGG 1 cut(s) 743
Bst4CI ACNGT 2 cut(s) 355, 665
Bst6I CTCTTC 1 cut(s) 631
BstDEI CTNAG 3 cut(s) 105, 468, 511
BstF5I GGATG 1 cut(s) 739
BstKTI GATC 6 cut(s) 31, 417, 459, 529, 604, 618
BstMBI GATC 6 cut(s) 28, 414, 456, 526, 601, 615
BstMWI GCNNNNNNNGC 4 cut(s) 89, 155, 164, 440
BstSLI GKGCMC 1 cut(s) 697
BtsCI GGATG 1 cut(s) 739
BtsIMutI CAGTG 1 cut(s) 897
BveI ACCTGC 2 cut(s) 439, 759
Cfr13I GGNCC 2 cut(s) 361, 794
Csp6I GTAC 5 cut(s) 171, 465, 501, 648, 772
CviAII CATG 4 cut(s) 7, 140, 295, 791
CviQI GTAC 5 cut(s) 171, 465, 501, 648, 772
DdeI CTNAG 3 cut(s) 105, 468, 511
DpnI GATC 6 cut(s) 30, 416, 458, 528, 603, 617
DpnII GATC 6 cut(s) 28, 414, 456, 526, 601, 615
DraI TTTAAA 1 cut(s) 349
Eam1104I CTCTTC 1 cut(s) 631
EarI CTCTTC 1 cut(s) 631
Eco130I CCWWGG 1 cut(s) 743
Eco47I GGWCC 2 cut(s) 361, 794
Eco57I CTGAAG 1 cut(s) 168
EcoRI GAATTC 1 cut(s) 381
EcoT14I CCWWGG 1 cut(s) 743
EcoT22I ATGCAT 1 cut(s) 823
ErhI CCWWGG 1 cut(s) 743
FaeI CATG 4 cut(s) 10, 143, 298, 794
FalI AAGNNNNNCTT 4 cut(s) 513, 545, 582, 614
FaqI GGGAC 1 cut(s) 374
FatI CATG 4 cut(s) 6, 139, 294, 790
FbaI TGATCA 2 cut(s) 456, 601
FokI GGATG 1 cut(s) 726
FspBI CTAG 3 cut(s) 164, 855, 943
GsuI CTGGAG 1 cut(s) 151
Hin1II CATG 4 cut(s) 10, 143, 298, 794
HindIII AAGCTT 1 cut(s) 273
HinfI GANTC 4 cut(s) 143, 473, 593, 748
HphI GGTGA 1 cut(s) 767
Hpy166II GTNNAC 2 cut(s) 503, 695
Hpy188I TCNGA 2 cut(s) 394, 452
Hpy188III TCNNGA 7 cut(s) 69, 307, 359, 418, 530, 599, 605
Hpy8I GTNNAC 2 cut(s) 503, 695
HpyAV CCTTC 2 cut(s) 75, 752
HpyCH4III ACNGT 2 cut(s) 355, 665
HpyCH4V TGCA 5 cut(s) 83, 298, 443, 695, 821
HpyF10VI GCNNNNNNNGC 4 cut(s) 89, 155, 164, 440
HpyF3I CTNAG 3 cut(s) 105, 468, 511
Hsp92II CATG 4 cut(s) 10, 143, 298, 794
Ksp22I TGATCA 2 cut(s) 456, 601
Kzo9I GATC 6 cut(s) 28, 414, 456, 526, 601, 615
LmnI GCTCC 1 cut(s) 565
LpnPI CCDG 9 cut(s) 78, 115, 117, 153, 320, 363, 444, 630, 754
MaeI CTAG 3 cut(s) 164, 855, 943
MalI GATC 6 cut(s) 30, 416, 458, 528, 603, 617
MboI GATC 6 cut(s) 28, 414, 456, 526, 601, 615
MboII GAAGA 3 cut(s) 174, 254, 618
MhlI GDGCHC 1 cut(s) 697
MluCI AATT 6 cut(s) 96, 381, 564, 782, 805, 811
MlyI GAGTC 2 cut(s) 137, 587
MmeI TCCRAC 1 cut(s) 936
MnlI CCTC 5 cut(s) 82, 126, 301, 565, 634
Mph1103I ATGCAT 1 cut(s) 823
MseI TTAA 4 cut(s) 348, 572, 641, 867
MslI CAYNNNNRTG 2 cut(s) 11, 690
MwoI GCNNNNNNNGC 4 cut(s) 89, 155, 164, 440
NdeII GATC 6 cut(s) 28, 414, 456, 526, 601, 615
NlaIII CATG 4 cut(s) 10, 143, 298, 794
NlaIV GGNNCC 1 cut(s) 362
NmeAIII GCCGAG 1 cut(s) 826
NsiI ATGCAT 1 cut(s) 823
PfeI GAWTC 2 cut(s) 473, 748
PleI GAGTC 2 cut(s) 137, 587
PpsI GAGTC 2 cut(s) 137, 587
PshBI ATTAAT 1 cut(s) 867
PsiI TTATAA 1 cut(s) 810
PspN4I GGNNCC 1 cut(s) 362
PspPI GGNCC 2 cut(s) 361, 794
RsaI GTAC 5 cut(s) 172, 466, 502, 649, 773
RsaNI GTAC 5 cut(s) 171, 465, 501, 648, 772
RseI CAYNNNNRTG 2 cut(s) 11, 690
SaqAI TTAA 4 cut(s) 348, 572, 641, 867
Sau3AI GATC 6 cut(s) 28, 414, 456, 526, 601, 615
Sau96I GGNCC 2 cut(s) 361, 794
SchI GAGTC 2 cut(s) 137, 587
SduI GDGCHC 1 cut(s) 697
SinI GGWCC 2 cut(s) 361, 794
SmiMI CAYNNNNRTG 2 cut(s) 11, 690
SmlI CTYRAG 1 cut(s) 702
SmoI CTYRAG 1 cut(s) 702
Sse9I AATT 6 cut(s) 96, 381, 564, 782, 805, 811
SspMI CTAG 3 cut(s) 164, 855, 943
StyI CCWWGG 1 cut(s) 743
TaaI ACNGT 2 cut(s) 355, 665
TaqI TCGA 2 cut(s) 519, 802
TasI AATT 6 cut(s) 96, 381, 564, 782, 805, 811
TfiI GAWTC 2 cut(s) 473, 748
Tru1I TTAA 4 cut(s) 348, 572, 641, 867
Tru9I TTAA 4 cut(s) 348, 572, 641, 867
TscAI CASTG 1 cut(s) 904
TspDTI ATGAA 4 cut(s) 183, 187, 414, 728
TspRI CASTG 1 cut(s) 904
VneI GTGCAC 1 cut(s) 693
VpaK11BI GGWCC 2 cut(s) 361, 794
VspI ATTAAT 1 cut(s) 867
XapI RAATTY 2 cut(s) 381, 782
XspI CTAG 3 cut(s) 164, 855, 943
Zsp2I ATGCAT 1 cut(s) 823
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.