Rmu_sc0000539.1_g000041

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000539.1
Physical Location & Seq
Reverse (-)
201623 .. 203002
1380 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000539.1_g000041.1.cds

Sequence Viewer

Length: 1131 bp
atgacagaagaaggtggtgtctcatccctgatggcaattaagtatcttacttggaaacaaaatgattatgttgttatgactttgcttactgctactctatccagtgatgtcatctcttttgttgttggaagtaatacttctagagaactttggtgtttgctcaaggagaggtttgcttctacttcatggtttaacaaagaaaaattaaagaccaacttttacgaacttcaaaaaggttcagattctattaacaagtacttagatcgagtgaagatagcttgtgatcaattggctaatataggaattcatatgactgatgaagacataattgacactgttcttcttggtttgccttcaaactatactactatgaaaaccataatcagggccatgcatatcccaatttcaacacaagcattaaggactcttttgctcattgctgaagctgaacttgaagaagctcacaggtctatttccttgcattccaagaatgaaattgtagcacatgatgatagtttcagaggggttactcctgcaccgactcttgttacaaatgtcaaatatgatgctaatgctttgatgtctacaactagtgtttcttcttctattgaatacactgaacagtccaagcctaatgcaaggtatatgatgagggatgctcctattgctgtgtctaatagaatctgctatgtcactgcatctgttcctacaatgaattctacatatgctgcaaatactgttatacaatatgcgagttccattatgcaatctatgcccatcaatgatcccacattcaaacaatggtttgtacaaccacaagaagatgttggatatgcttacaataatggtggaattcagttcaacgaagcattcaattctggggctactcatcaaaatgaaggtctcatacaacatggtttctcacaacagagtgaaggtcataatgcagctgaatgctttcataggcattgctatgctttccaaccaccaacttttgcaatacctcaatctatagctgcttctttttcatctcatccaatgcaagtcgtcattgatgatcaacctagtctttgtcatcccttgtttcatgataatgcttctcagttactgcctccctttcctcctggctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

376

Amino Acids

41.84

Weight (kDa)

5.59

Isoelectric Point (pI)

49.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 584
AclWI GGATC 1 cut(s) 779
AcsI RAATTY 3 cut(s) 303, 715, 852
AcuI CTGAAG 1 cut(s) 462
AfaI GTAC 2 cut(s) 257, 810
AfiI CCNNNNNNNGG 1 cut(s) 384
AgsI TTSAA 8 cut(s) 230, 357, 408, 455, 611, 796, 862, 874
AhlI ACTAGT 1 cut(s) 590
AjnI CCWGG 1 cut(s) 1123
AluBI AGCT 5 cut(s) 278, 446, 461, 950, 1016
AluI AGCT 5 cut(s) 278, 446, 461, 950, 1016
Alw26I GTCTC 2 cut(s) 25, 908
AlwI GGATC 1 cut(s) 779
AlwNI CAGNNNCTG 1 cut(s) 1108
AoxI GGCC 1 cut(s) 387
ApeKI GCWGC 3 cut(s) 728, 947, 1016
ApoI RAATTY 3 cut(s) 303, 715, 852
ArsI GACNNNNNNTTYG 2 cut(s) 886, 918
Asp700I GAANNNNTTC 1 cut(s) 957
AspS9I GGNCC 1 cut(s) 387
BarI GAAGNNNNNNTAC 2 cut(s) 891, 923
BbsI GAAGAC 1 cut(s) 327
BbvI GCAGC 3 cut(s) 715, 959, 1003
BccI CCATC 2 cut(s) 25, 785
BciT130I CCWGG 1 cut(s) 1125
BclI TGATCA 2 cut(s) 283, 1057
BcoDI GTCTC 2 cut(s) 25, 908
BcuI ACTAGT 1 cut(s) 590
BfaI CTAG 3 cut(s) 141, 591, 1065
BfmI CTRYAG 1 cut(s) 1011
BisI GCNGC 3 cut(s) 729, 948, 1017
BlsI GCNGC 3 cut(s) 730, 949, 1018
BmcAI AGTACT 1 cut(s) 257
Bme1390I CCNGG 1 cut(s) 1125
BmgT120I GGNCC 1 cut(s) 387
BmrFI CCNGG 1 cut(s) 1125
BmsI GCATC 3 cut(s) 556, 646, 707
BpiI GAAGAC 1 cut(s) 327
BplI GAGNNNNNCTC 2 cut(s) 643, 675
BpuEI CTTGAG 1 cut(s) 146
BsaI GGTCTC 1 cut(s) 908
Bsc4I CCNNNNNNNGG 1 cut(s) 384
Bse1I ACTGG 1 cut(s) 102
Bse3DI GCAATG 2 cut(s) 435, 967
BseBI CCWGG 1 cut(s) 1125
BseGI GGATG 4 cut(s) 23, 661, 1033, 1075
BseLI CCNNNNNNNGG 1 cut(s) 384
BseMI GCAATG 2 cut(s) 435, 967
BseMII CTCAG 1 cut(s) 1115
BseNI ACTGG 1 cut(s) 102
BseXI GCAGC 3 cut(s) 715, 959, 1003
BsgI GTGCAG 1 cut(s) 519
BshFI GGCC 1 cut(s) 389
BslI CCNNNNNNNGG 1 cut(s) 384
BsmAI GTCTC 2 cut(s) 25, 908
BsmI GAATGC 3 cut(s) 481, 869, 959
BsnI GGCC 1 cut(s) 389
Bso31I GGTCTC 1 cut(s) 908
Bsp1407I TGTACA 1 cut(s) 808
Bsp143I GATC 4 cut(s) 262, 283, 784, 1057
BspANI GGCC 1 cut(s) 389
BspCNI CTCAG 1 cut(s) 1114
BspHI TCATGA 1 cut(s) 1087
BspPI GGATC 1 cut(s) 779
BspTNI GGTCTC 1 cut(s) 908
BsrDI GCAATG 2 cut(s) 435, 967
BsrGI TGTACA 1 cut(s) 808
BsrI ACTGG 1 cut(s) 102
BssMI GATC 4 cut(s) 262, 283, 784, 1057
Bst2UI CCWGG 1 cut(s) 1125
Bst4CI ACNGT 3 cut(s) 337, 624, 739
BstAPI GCANNNNNTGC 1 cut(s) 772
BstAUI TGTACA 1 cut(s) 808
BstDEI CTNAG 2 cut(s) 259, 1101
BstF5I GGATG 4 cut(s) 23, 661, 1033, 1075
BstKTI GATC 4 cut(s) 265, 286, 787, 1060
BstMAI GTCTC 2 cut(s) 25, 908
BstMBI GATC 4 cut(s) 262, 283, 784, 1057
BstMWI GCNNNNNNNGC 2 cut(s) 665, 772
BstNI CCWGG 1 cut(s) 1125
BstSCI CCNGG 1 cut(s) 1123
BstSFI CTRYAG 1 cut(s) 1011
BstV1I GCAGC 3 cut(s) 715, 959, 1003
BstV2I GAAGAC 1 cut(s) 327
BsuRI GGCC 1 cut(s) 389
BtsCI GGATG 4 cut(s) 23, 661, 1033, 1075
BtsI GCAGTG 1 cut(s) 693
BtsIMutI CAGTG 4 cut(s) 109, 333, 615, 693
CaiI CAGNNNCTG 1 cut(s) 1108
CciI TCATGA 1 cut(s) 1087
Cfr13I GGNCC 1 cut(s) 387
Csp6I GTAC 2 cut(s) 256, 809
CspCI CAANNNNNGTGG 2 cut(s) 829, 864
CviAII CATG 5 cut(s) 186, 391, 506, 914, 1088
CviQI GTAC 2 cut(s) 256, 809
DdeI CTNAG 2 cut(s) 259, 1101
DpnI GATC 4 cut(s) 264, 285, 786, 1059
DpnII GATC 4 cut(s) 262, 283, 784, 1057
Eco31I GGTCTC 1 cut(s) 908
Eco57I CTGAAG 1 cut(s) 462
EcoRI GAATTC 3 cut(s) 303, 715, 852
EcoRII CCWGG 1 cut(s) 1123
EcoT22I ATGCAT 1 cut(s) 396
FaeI CATG 5 cut(s) 189, 394, 509, 917, 1091
FalI AAGNNNNNCTT 6 cut(s) 121, 153, 200, 232, 435, 467
FatI CATG 5 cut(s) 185, 390, 505, 913, 1087
FauNDI CATATG 2 cut(s) 309, 724
FbaI TGATCA 2 cut(s) 283, 1057
FblI GTMKAC 1 cut(s) 584
Fnu4HI GCNGC 3 cut(s) 729, 948, 1017
FokI GGATG 4 cut(s) 10, 668, 1020, 1062
Fsp4HI GCNGC 3 cut(s) 729, 948, 1017
FspBI CTAG 3 cut(s) 141, 591, 1065
GluI GCNGC 3 cut(s) 729, 948, 1017
HaeIII GGCC 1 cut(s) 389
Hin1II CATG 5 cut(s) 189, 394, 509, 917, 1091
HinfI GANTC 4 cut(s) 242, 424, 541, 681
Hpy166II GTNNAC 1 cut(s) 585
Hpy188I TCNGA 2 cut(s) 241, 521
Hpy188III TCNNGA 2 cut(s) 141, 1088
Hpy8I GTNNAC 1 cut(s) 585
HpyAV CCTTC 4 cut(s) 5, 363, 893, 929
HpyCH4III ACNGT 3 cut(s) 337, 624, 739
HpyF10VI GCNNNNNNNGC 2 cut(s) 665, 772
HpyF3I CTNAG 2 cut(s) 259, 1101
Hsp92II CATG 5 cut(s) 189, 394, 509, 917, 1091
Ksp22I TGATCA 2 cut(s) 283, 1057
Kzo9I GATC 4 cut(s) 262, 283, 784, 1057
LmnI GCTCC 1 cut(s) 664
LpnPI CCDG 7 cut(s) 41, 115, 370, 451, 546, 864, 1110
Lsp1109I GCAGC 3 cut(s) 715, 959, 1003
LweI GCATC 3 cut(s) 556, 646, 707
MaeI CTAG 3 cut(s) 141, 591, 1065
MaeIII GTNAC 4 cut(s) 526, 547, 691, 1104
MalI GATC 4 cut(s) 264, 285, 786, 1059
MboI GATC 4 cut(s) 262, 283, 784, 1057
MboII GAAGA 8 cut(s) 20, 283, 332, 332, 467, 591, 594, 833
MfeI CAATTG 1 cut(s) 287
MlyI GAGTC 2 cut(s) 418, 535
MmeI TCCRAC 3 cut(s) 106, 808, 1006
MnlI CCTC 6 cut(s) 162, 515, 645, 1014, 1122, 1131
Mph1103I ATGCAT 1 cut(s) 396
MroXI GAANNNNTTC 1 cut(s) 957
MseI TTAA 5 cut(s) 39, 192, 206, 249, 419
MslI CAYNNNNRTG 3 cut(s) 894, 972, 1092
MspA1I CMGCKG 1 cut(s) 950
MspR9I CCNGG 1 cut(s) 1125
MunI CAATTG 1 cut(s) 287
Mva1269I GAATGC 3 cut(s) 481, 869, 959
MvaI CCWGG 1 cut(s) 1125
MwoI GCNNNNNNNGC 2 cut(s) 665, 772
NdeI CATATG 2 cut(s) 309, 724
NdeII GATC 4 cut(s) 262, 283, 784, 1057
NlaIII CATG 5 cut(s) 189, 394, 509, 917, 1091
NmuCI GTSAC 1 cut(s) 691
NsiI ATGCAT 1 cut(s) 396
PagI TCATGA 1 cut(s) 1087
PctI GAATGC 3 cut(s) 481, 869, 959
PdmI GAANNNNTTC 1 cut(s) 957
PfeI GAWTC 2 cut(s) 242, 681
PkrI GCNGC 3 cut(s) 730, 949, 1018
PleI GAGTC 2 cut(s) 418, 535
PpsI GAGTC 2 cut(s) 418, 535
Psp6I CCWGG 1 cut(s) 1123
PspGI CCWGG 1 cut(s) 1123
PspPI GGNCC 1 cut(s) 387
PstNI CAGNNNCTG 1 cut(s) 1108
PvuII CAGCTG 1 cut(s) 950
RsaI GTAC 2 cut(s) 257, 810
RsaNI GTAC 2 cut(s) 256, 809
RseI CAYNNNNRTG 3 cut(s) 894, 972, 1092
SaqAI TTAA 5 cut(s) 39, 192, 206, 249, 419
SatI GCNGC 3 cut(s) 729, 948, 1017
Sau3AI GATC 4 cut(s) 262, 283, 784, 1057
Sau96I GGNCC 1 cut(s) 387
ScaI AGTACT 1 cut(s) 257
SchI GAGTC 2 cut(s) 418, 535
ScrFI CCNGG 1 cut(s) 1125
SfaNI GCATC 3 cut(s) 556, 646, 707
SfcI CTRYAG 1 cut(s) 1011
SmiMI CAYNNNNRTG 3 cut(s) 894, 972, 1092
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
SpeI ACTAGT 1 cut(s) 590
SspMI CTAG 3 cut(s) 141, 591, 1065
StyD4I CCNGG 1 cut(s) 1123
TaaI ACNGT 3 cut(s) 337, 624, 739
TaqI TCGA 1 cut(s) 265
TatI WGTACW 2 cut(s) 255, 808
TfiI GAWTC 2 cut(s) 242, 681
Tru1I TTAA 5 cut(s) 39, 192, 206, 249, 419
Tru9I TTAA 5 cut(s) 39, 192, 206, 249, 419
TscAI CASTG 4 cut(s) 109, 340, 622, 700
TseFI GTSAC 1 cut(s) 691
TseI GCWGC 3 cut(s) 728, 947, 1016
Tsp45I GTSAC 1 cut(s) 691
TspRI CASTG 4 cut(s) 109, 340, 622, 700
XapI RAATTY 3 cut(s) 303, 715, 852
XbaI TCTAGA 1 cut(s) 140
XmiI GTMKAC 1 cut(s) 584
XmnI GAANNNNTTC 1 cut(s) 957
XspI CTAG 3 cut(s) 141, 591, 1065
ZrmI AGTACT 1 cut(s) 257
Zsp2I ATGCAT 1 cut(s) 396
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.