RchiOBHm_Chr7g0178931
RLK Family

cysteine-rich RLK (RECEPTOR-like protein kinase) 8

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0001340
Physical Location & Seq
Forward (+)
1423858 .. 1425437
1580 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ15945

Sequence Viewer

Length: 591 bp
ATGGCCACTAGTCAAACTCCATTTCAGATTTATATGTTGCTTAGTATGATGACAAGAAGATTGAATGACAATAACTTCATTACTTGGAGCTACCAACTGCAAACTCTTTTAGAAGGACATGATCTCTTTGGTTATATTGATGGCAATACTCTTTGTCCTACAAAGTATGTGATCACTGATGATGAGGGAGTAACAGGTGAGATAACTGCAACTTACAAAGAGTGGATGAAGACTGACAAGGCCATATTAAGCCTTCTAATTGCCACACTCTCTTCTGATACAAGGGATTATGTGGTGGGCAGCAAGACATCAAGAGAAGCATGGATGAGGTTGAATGATAGATATGCAACAGTTTCGAGATCATATGTCATGCAATTAAAAACTGATCTATATACAATTACAAAGGGAATGGATTTTGTTGAGAAATATTTGATGAAAATCACACGTGCAAGGAACCAATTAGATGCTTTGGGAGTAAGGATGGAAGACCAGGATATTGTTGTGGTTTTACTCAATGGTTTGCCTGCAGAATTTAATATCATAAAAGCAATTATTCGGGCAAGGAAAACCCAATTACAATGCAAGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 Retrotran_gag_2 Retrotran_gag_3 Retrotrans_gag gag_pre-integrs rve

Protein Analysis

196

Amino Acids

22.58

Weight (kDa)

8.45

Isoelectric Point (pI)

26.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_2 PF14223 34 - 193 3.4e-21 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 530
AcvI CACGTG 1 cut(s) 446
AflIII ACRYGT 1 cut(s) 443
AgsI TTSAA 2 cut(s) 64, 334
AhlI ACTAGT 1 cut(s) 8
AjnI CCWGG 1 cut(s) 489
AluBI AGCT 1 cut(s) 90
AluI AGCT 1 cut(s) 90
AoxI GGCC 2 cut(s) 3, 240
ApeKI GCWGC 1 cut(s) 300
ApoI RAATTY 1 cut(s) 530
AsuHPI GGTGA 1 cut(s) 209
BalI TGGCCA 1 cut(s) 5
BbrPI CACGTG 1 cut(s) 446
BbsI GAAGAC 2 cut(s) 236, 492
BbvI GCAGC 1 cut(s) 312
BccI CCATC 2 cut(s) 134, 475
BcgI CGANNNNNNTGC 2 cut(s) 336, 370
BciT130I CCWGG 1 cut(s) 491
BclI TGATCA 1 cut(s) 171
BcuI ACTAGT 1 cut(s) 8
BfaI CTAG 1 cut(s) 9
BfmI CTRYAG 1 cut(s) 525
BisI GCNGC 1 cut(s) 301
BlsI GCNGC 1 cut(s) 302
Bme1390I CCNGG 1 cut(s) 491
BmiI GGNNCC 1 cut(s) 455
BmrFI CCNGG 1 cut(s) 491
BmsI GCATC 1 cut(s) 454
BpiI GAAGAC 2 cut(s) 236, 492
BsaAI YACGTR 1 cut(s) 446
BsaBI GATNNNNATC 1 cut(s) 437
Bse8I GATNNNNATC 1 cut(s) 437
BseBI CCWGG 1 cut(s) 491
BseGI GGATG 3 cut(s) 231, 330, 486
BseJI GATNNNNATC 1 cut(s) 437
BseXI GCAGC 1 cut(s) 312
BshFI GGCC 2 cut(s) 5, 242
BsnI GGCC 2 cut(s) 5, 242
Bsp143I GATC 4 cut(s) 121, 171, 359, 385
BspANI GGCC 2 cut(s) 5, 242
BspLI GGNNCC 1 cut(s) 455
BspMAI CTGCAG 1 cut(s) 529
BssMI GATC 4 cut(s) 121, 171, 359, 385
Bst2UI CCWGG 1 cut(s) 491
Bst4CI ACNGT 1 cut(s) 352
Bst6I CTCTTC 1 cut(s) 277
BstBAI YACGTR 1 cut(s) 446
BstC8I GCNNGC 1 cut(s) 525
BstDEI CTNAG 1 cut(s) 41
BstF5I GGATG 3 cut(s) 231, 330, 486
BstKTI GATC 4 cut(s) 124, 174, 362, 388
BstMBI GATC 4 cut(s) 121, 171, 359, 385
BstNI CCWGG 1 cut(s) 491
BstSCI CCNGG 1 cut(s) 489
BstSFI CTRYAG 1 cut(s) 525
BstV1I GCAGC 1 cut(s) 312
BstV2I GAAGAC 2 cut(s) 236, 492
BsuRI GGCC 2 cut(s) 5, 242
BtsCI GGATG 3 cut(s) 231, 330, 486
BtsIMutI CAGTG 1 cut(s) 174
Cac8I GCNNGC 1 cut(s) 525
CviAII CATG 3 cut(s) 119, 321, 370
CviJI RGCY 4 cut(s) 5, 90, 242, 252
CviKI_1 RGCY 4 cut(s) 5, 90, 242, 252
DdeI CTNAG 1 cut(s) 41
DpnI GATC 4 cut(s) 123, 173, 361, 387
DpnII GATC 4 cut(s) 121, 171, 359, 385
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 277
EarI CTCTTC 1 cut(s) 277
Eco72I CACGTG 1 cut(s) 446
EcoRII CCWGG 1 cut(s) 489
FaeI CATG 3 cut(s) 122, 324, 373
FatI CATG 3 cut(s) 118, 320, 369
FauNDI CATATG 1 cut(s) 364
FbaI TGATCA 1 cut(s) 171
Fnu4HI GCNGC 1 cut(s) 301
FokI GGATG 3 cut(s) 238, 337, 493
Fsp4HI GCNGC 1 cut(s) 301
FspBI CTAG 1 cut(s) 9
GluI GCNGC 1 cut(s) 301
HaeIII GGCC 2 cut(s) 5, 242
Hin1II CATG 3 cut(s) 122, 324, 373
HphI GGTGA 1 cut(s) 209
Hpy188I TCNGA 2 cut(s) 27, 277
Hpy188III TCNNGA 2 cut(s) 312, 357
HpyAV CCTTC 2 cut(s) 107, 263
HpyCH4III ACNGT 1 cut(s) 352
HpyCH4IV ACGT 1 cut(s) 445
HpyCH4V TGCA 7 cut(s) 100, 209, 347, 373, 449, 527, 582
HpyF3I CTNAG 1 cut(s) 41
HpySE526I ACGT 1 cut(s) 445
Hsp92II CATG 3 cut(s) 122, 324, 373
Ksp22I TGATCA 1 cut(s) 171
Kzo9I GATC 4 cut(s) 121, 171, 359, 385
LmnI GCTCC 1 cut(s) 87
LpnPI CCDG 4 cut(s) 180, 476, 503, 537
Lsp1109I GCAGC 1 cut(s) 312
LweI GCATC 1 cut(s) 454
MaeI CTAG 1 cut(s) 9
MaeII ACGT 1 cut(s) 445
MaeIII GTNAC 1 cut(s) 190
MalI GATC 4 cut(s) 123, 173, 361, 387
MboI GATC 4 cut(s) 121, 171, 359, 385
MboII GAAGA 4 cut(s) 69, 241, 264, 497
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 8 cut(s) 258, 374, 396, 458, 530, 549, 572, 586
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 2 cut(s) 178, 321
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 3 cut(s) 248, 377, 534
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 491
MvaI CCWGG 1 cut(s) 491
NdeI CATATG 1 cut(s) 364
NdeII GATC 4 cut(s) 121, 171, 359, 385
NlaIII CATG 3 cut(s) 122, 324, 373
NlaIV GGNNCC 1 cut(s) 455
PkrI GCNGC 1 cut(s) 302
PmaCI CACGTG 1 cut(s) 446
PmlI CACGTG 1 cut(s) 446
Ppu21I YACGTR 1 cut(s) 446
Psp6I CCWGG 1 cut(s) 489
PspCI CACGTG 1 cut(s) 446
PspGI CCWGG 1 cut(s) 489
PspN4I GGNNCC 1 cut(s) 455
PstI CTGCAG 1 cut(s) 529
SaqAI TTAA 3 cut(s) 248, 377, 534
SatI GCNGC 1 cut(s) 301
Sau3AI GATC 4 cut(s) 121, 171, 359, 385
ScrFI CCNGG 1 cut(s) 491
SetI ASST 4 cut(s) 92, 199, 332, 448
SfaNI GCATC 1 cut(s) 454
SfcI CTRYAG 1 cut(s) 525
SpeI ACTAGT 1 cut(s) 8
Sse9I AATT 8 cut(s) 258, 374, 396, 458, 530, 549, 572, 586
SspI AATATT 1 cut(s) 428
SspMI CTAG 1 cut(s) 9
StyD4I CCNGG 1 cut(s) 489
TaaI ACNGT 1 cut(s) 352
TaiI ACGT 1 cut(s) 448
TaqI TCGA 1 cut(s) 356
TasI AATT 8 cut(s) 258, 374, 396, 458, 530, 549, 572, 586
Tru1I TTAA 3 cut(s) 248, 377, 534
Tru9I TTAA 3 cut(s) 248, 377, 534
TscAI CASTG 1 cut(s) 181
TseI GCWGC 1 cut(s) 300
TspDTI ATGAA 3 cut(s) 67, 242, 449
TspRI CASTG 1 cut(s) 181
XapI RAATTY 1 cut(s) 530
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.