Rmu_sc0001706.1_g000020

GAG-pre-integrase domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001706.1
OG0001340
Physical Location & Seq
Reverse (-)
82514 .. 83017
504 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001706.1_g000020.1.cds

Sequence Viewer

Length: 504 bp
atggagaatgataaagcattgatgactcttatctctgcctctttatctagtgaagcattatcatttgtggttggaagccataattcatgtgaagtgtggaaaaatttgattgtgagatatggtgtctcttctagatcagccgctatgcaactccaaacaaacctgtacagaattcagaaaggtaatgacactatagacaagtattttcagtgtatcaaggacattactgatcaattagcttctattggcattcatattcccgatgaagagattattatcattgctgtcaatggccttccctctaaatacatgactatcaaaatcgtgatcaaagctcagatcacaattatgttaatgaacaaactgcattctcttttacttgatgaggagtctactatggatcaatctaaaaagtctatgcaggttcctcactcaacagcaattgttacagggaatgcttattatgcaagttcctcactcaatagcaattgttacagggaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 gag_pre-integrs rve

Protein Analysis

167

Amino Acids

18.6

Weight (kDa)

6.41

Isoelectric Point (pI)

29.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 412
AccI GTMKAC 1 cut(s) 392
AciI CCGC 1 cut(s) 141
AclWI GGATC 1 cut(s) 408
AcsI RAATTY 2 cut(s) 103, 171
AfaI GTAC 1 cut(s) 167
AluBI AGCT 2 cut(s) 239, 335
AluI AGCT 2 cut(s) 239, 335
Alw26I GTCTC 1 cut(s) 130
AlwI GGATC 1 cut(s) 408
AoxI GGCC 1 cut(s) 292
ApoI RAATTY 2 cut(s) 103, 171
BclI TGATCA 2 cut(s) 229, 327
BcoDI GTCTC 1 cut(s) 130
BfaI CTAG 2 cut(s) 48, 132
BfmI CTRYAG 1 cut(s) 192
BfuAI ACCTGC 1 cut(s) 412
BisI GCNGC 1 cut(s) 141
BlsI GCNGC 1 cut(s) 142
BmiI GGNNCC 1 cut(s) 426
BsaBI GATNNNNATC 1 cut(s) 275
Bse3DI GCAATG 1 cut(s) 279
Bse8I GATNNNNATC 1 cut(s) 275
BseJI GATNNNNATC 1 cut(s) 275
BseMI GCAATG 1 cut(s) 279
BseMII CTCAG 1 cut(s) 350
BseRI GAGGAG 1 cut(s) 401
BshFI GGCC 1 cut(s) 294
BsmAI GTCTC 1 cut(s) 130
BsmI GAATGC 3 cut(s) 249, 367, 460
BsnI GGCC 1 cut(s) 294
Bsp1407I TGTACA 1 cut(s) 165
Bsp143I GATC 5 cut(s) 134, 229, 327, 339, 400
BspACI CCGC 1 cut(s) 141
BspANI GGCC 1 cut(s) 294
BspCNI CTCAG 1 cut(s) 349
BspLI GGNNCC 1 cut(s) 426
BspMI ACCTGC 1 cut(s) 412
BspPI GGATC 1 cut(s) 408
BsrDI GCAATG 1 cut(s) 279
BsrGI TGTACA 1 cut(s) 165
BssMI GATC 5 cut(s) 134, 229, 327, 339, 400
Bst6I CTCTTC 2 cut(s) 133, 261
BstAUI TGTACA 1 cut(s) 165
BstDEI CTNAG 1 cut(s) 336
BstKTI GATC 5 cut(s) 137, 232, 330, 342, 403
BstMAI GTCTC 1 cut(s) 130
BstMBI GATC 5 cut(s) 134, 229, 327, 339, 400
BstMWI GCNNNNNNNGC 1 cut(s) 464
BstSFI CTRYAG 1 cut(s) 192
BsuRI GGCC 1 cut(s) 294
BtsIMutI CAGTG 1 cut(s) 215
BveI ACCTGC 1 cut(s) 412
Csp6I GTAC 1 cut(s) 166
CviAII CATG 2 cut(s) 87, 310
CviJI RGCY 5 cut(s) 78, 140, 239, 294, 335
CviKI_1 RGCY 5 cut(s) 78, 140, 239, 294, 335
CviQI GTAC 1 cut(s) 166
DdeI CTNAG 1 cut(s) 336
DpnI GATC 5 cut(s) 136, 231, 329, 341, 402
DpnII GATC 5 cut(s) 134, 229, 327, 339, 400
Eam1104I CTCTTC 2 cut(s) 133, 261
EarI CTCTTC 2 cut(s) 133, 261
EcoRI GAATTC 1 cut(s) 171
FaeI CATG 2 cut(s) 90, 313
FatI CATG 2 cut(s) 86, 309
FbaI TGATCA 2 cut(s) 229, 327
FblI GTMKAC 1 cut(s) 392
Fnu4HI GCNGC 1 cut(s) 141
Fsp4HI GCNGC 1 cut(s) 141
FspBI CTAG 2 cut(s) 48, 132
GluI GCNGC 1 cut(s) 141
HaeIII GGCC 1 cut(s) 294
Hin1II CATG 2 cut(s) 90, 313
HinfI GANTC 2 cut(s) 25, 389
Hpy166II GTNNAC 1 cut(s) 393
Hpy188I TCNGA 2 cut(s) 177, 339
Hpy188III TCNNGA 3 cut(s) 132, 260, 325
Hpy8I GTNNAC 1 cut(s) 393
HpyAV CCTTC 1 cut(s) 305
HpyCH4V TGCA 4 cut(s) 148, 367, 421, 467
HpyF10VI GCNNNNNNNGC 1 cut(s) 464
HpyF3I CTNAG 1 cut(s) 336
Hsp92II CATG 2 cut(s) 90, 313
Ksp22I TGATCA 2 cut(s) 229, 327
Kzo9I GATC 5 cut(s) 134, 229, 327, 339, 400
LpnPI CCDG 4 cut(s) 176, 407, 435, 481
MaeI CTAG 2 cut(s) 48, 132
MaeIII GTNAC 2 cut(s) 445, 491
MalI GATC 5 cut(s) 136, 231, 329, 341, 402
MboI GATC 5 cut(s) 134, 229, 327, 339, 400
MboII GAAGA 2 cut(s) 120, 278
MfeI CAATTG 2 cut(s) 441, 487
MluCI AATT 7 cut(s) 82, 103, 171, 233, 345, 441, 487
MlyI GAGTC 2 cut(s) 19, 398
MmeI TCCRAC 1 cut(s) 52
MnlI CCTC 5 cut(s) 49, 310, 379, 438, 484
MseI TTAA 1 cut(s) 353
MslI CAYNNNNRTG 1 cut(s) 347
MunI CAATTG 2 cut(s) 441, 487
Mva1269I GAATGC 3 cut(s) 249, 367, 460
MwoI GCNNNNNNNGC 1 cut(s) 464
NdeII GATC 5 cut(s) 134, 229, 327, 339, 400
NlaIII CATG 2 cut(s) 90, 313
NlaIV GGNNCC 1 cut(s) 426
PctI GAATGC 3 cut(s) 249, 367, 460
PkrI GCNGC 1 cut(s) 142
PleI GAGTC 2 cut(s) 19, 397
PpsI GAGTC 2 cut(s) 19, 397
PspN4I GGNNCC 1 cut(s) 426
RsaI GTAC 1 cut(s) 167
RsaNI GTAC 1 cut(s) 166
RseI CAYNNNNRTG 1 cut(s) 347
SaqAI TTAA 1 cut(s) 353
SatI GCNGC 1 cut(s) 141
Sau3AI GATC 5 cut(s) 134, 229, 327, 339, 400
SchI GAGTC 2 cut(s) 19, 398
SetI ASST 5 cut(s) 165, 184, 241, 337, 426
SfcI CTRYAG 1 cut(s) 192
SmiMI CAYNNNNRTG 1 cut(s) 347
Sse9I AATT 7 cut(s) 82, 103, 171, 233, 345, 441, 487
SsiI CCGC 1 cut(s) 141
SspMI CTAG 2 cut(s) 48, 132
TasI AATT 7 cut(s) 82, 103, 171, 233, 345, 441, 487
TatI WGTACW 1 cut(s) 165
TauI GCSGC 1 cut(s) 143
Tru1I TTAA 1 cut(s) 353
Tru9I TTAA 1 cut(s) 353
TscAI CASTG 1 cut(s) 215
TspDTI ATGAA 4 cut(s) 75, 242, 279, 371
TspRI CASTG 1 cut(s) 215
XapI RAATTY 2 cut(s) 103, 171
XbaI TCTAGA 1 cut(s) 131
XmiI GTMKAC 1 cut(s) 392
XspI CTAG 2 cut(s) 48, 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.