Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003371.1

Orthogroup ID

OG0001340

Physical Location & Seq

Genomic Coordinates Forward (+)

24108 .. 24668

Gene Structure 561 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003371.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 561 bp

atgaggtatgcctctacttcttggtttaacaaaaagcaactaaagagcaacttttacaaacttcaaaaagggtcagattctattgacaactacctggatcgagtgaaaattgcttgtgatcagttggctaatgtagggattcatatgacagatgaagacataattgtctctgttcttcttggtttgccatcagcctatactactatgaagactataatcaggcctgagttaaggtctcttttgctcattgctgaagctgaacttggtttgcctactagtttgtctcaacgtgttgttggcttcaatcctgttagtttggctatgccttttaactgctctacacctactaacacaagcatatataatatgccaactcttccaaccaattttgtggtccacagtgttgagtaccctcaatatcttgctctgaatttaaatggatcatttaccctgcattctggatgtgtggctcaaaatgctcaaaatggaggttcacatagtaactttggtgtcaacagtggaagcaatttgtctcagcaatcctacattgggcctcaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_2 Retrotran_gag_2

Protein Analysis

186

Amino Acids

20.37

Weight (kDa)

7.73

Isoelectric Point (pI)

35.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001340)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g05651 FvH4_5g06481
malus_domestica	MD04G1150100.v1.1
rosa_chinensis	RchiOBHm_Chr1g0366871 RchiOBHm_Chr2g0112811 RchiOBHm_Chr5g0022021 RchiOBHm_Chr5g0050161 RchiOBHm_Chr7g0178931
rosa_laevigata	RLG00000030270 RLG00000030274 RLG00000030285 RLG00000030289
rosa_multiflora	Rmu_sc0000206.1_g000011 Rmu_sc0000539.1_g000041 Rmu_sc0001706.1_g000020 Rmu_sc0002245.1_g000029 Rmu_sc0002935.1_g000016 Rmu_sc0002952.1_g000016 Rmu_sc0002952.1_g000017 Rmu_sc0003371.1_g000005 Rmu_sc0004193.1_g000005 Rmu_sc0004359.1_g000018 Rmu_sc0006422.1_g000014 Rmu_sc0007594.1_g000001 Rmu_sc0010925.1_g000018 Rmu_sc0013146.1_g000003 Rmu_sc0031630.1_g000002 Rmu_sc0033466.1_g000001 Rmu_ssc0000079.1_g000006 Rmu_ssc0000423.1_g000006
rosa_roxburghii	Rroxscaffold_1G00004520 Rroxscaffold_1G00005520 Rroxscaffold_1G00041540 Rroxscaffold_1G00045310 Rroxscaffold_5G00361650 Rroxscaffold_6G00388920 Rroxscaffold_6G00405980 Rroxscaffold_6G00410140 Rroxscaffold_6G00423840 Rroxscaffold_7G00200050
rosa_rugosa	Rorug02G0433500 Rorug02G0433600 Rorug02G0433600 Rorug02G0433700 Rorug04G0166100.1 Rorug05G0053500 Rorug06G0481300
rosa_samantha	Rh1CG036200 Rh4AG051700 Rh4BG049000 Rh4CG055700
rosa_wichuraiana	Rw0G022690 Rw1G035930 Rw4G004120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	164
AclWI	GGATC	2 cut(s)	105, 448
AcsI	RAATTY	1 cut(s)	430
AcuI	CTGAAG	1 cut(s)	273
AfaI	GTAC	1 cut(s)	410
AfiI	CCNNNNNNNGG	1 cut(s)	549
AflIII	ACRYGT	1 cut(s)	289
AgsI	TTSAA	2 cut(s)	65, 304
AhlI	ACTAGT	1 cut(s)	275
AjnI	CCWGG	1 cut(s)	93
AjuI	GAANNNNNNNTTGG	2 cut(s)	246, 278
AluBI	AGCT	1 cut(s)	257
AluI	AGCT	1 cut(s)	257
Alw26I	GTCTC	4 cut(s)	172, 240, 288, 537
AlwI	GGATC	2 cut(s)	105, 448
AoxI	GGCC	2 cut(s)	221, 551
ApoI	RAATTY	1 cut(s)	430
AspS9I	GGNCC	2 cut(s)	394, 551
AvaII	GGWCC	1 cut(s)	394
BbsI	GAAGAC	2 cut(s)	162, 215
BccI	CCATC	1 cut(s)	196
BciT130I	CCWGG	1 cut(s)	95
BclI	TGATCA	1 cut(s)	118
BcoDI	GTCTC	4 cut(s)	172, 240, 288, 537
BcuI	ACTAGT	1 cut(s)	275
BfaI	CTAG	1 cut(s)	276
Bme1390I	CCNGG	1 cut(s)	95
Bme18I	GGWCC	1 cut(s)	394
BmgT120I	GGNCC	2 cut(s)	394, 551
BmrFI	CCNGG	1 cut(s)	95
BpiI	GAAGAC	2 cut(s)	162, 215
BsaI	GGTCTC	1 cut(s)	240
Bsc4I	CCNNNNNNNGG	1 cut(s)	549
Bse3DI	GCAATG	1 cut(s)	246
BseBI	CCWGG	1 cut(s)	95
BseGI	GGATG	1 cut(s)	467
BseLI	CCNNNNNNNGG	1 cut(s)	549
BseMI	GCAATG	1 cut(s)	246
BseMII	CTCAG	2 cut(s)	216, 548
BshFI	GGCC	2 cut(s)	223, 553
BslI	CCNNNNNNNGG	1 cut(s)	549
BsmAI	GTCTC	4 cut(s)	172, 240, 288, 537
BsmI	GAATGC	1 cut(s)	454
BsnI	GGCC	2 cut(s)	223, 553
Bso31I	GGTCTC	1 cut(s)	240
Bsp143I	GATC	3 cut(s)	97, 118, 440
BspANI	GGCC	2 cut(s)	223, 553
BspCNI	CTCAG	2 cut(s)	217, 547
BspPI	GGATC	2 cut(s)	105, 448
BspTNI	GGTCTC	1 cut(s)	240
BsrDI	GCAATG	1 cut(s)	246
BssMI	GATC	3 cut(s)	97, 118, 440
Bst2UI	CCWGG	1 cut(s)	95
Bst4CI	ACNGT	2 cut(s)	401, 518
Bst6I	CTCTTC	1 cut(s)	381
BstDEI	CTNAG	2 cut(s)	225, 534
BstF5I	GGATG	1 cut(s)	467
BstKTI	GATC	3 cut(s)	100, 121, 443
BstMAI	GTCTC	4 cut(s)	172, 240, 288, 537
BstMBI	GATC	3 cut(s)	97, 118, 440
BstMWI	GCNNNNNNNGC	1 cut(s)	476
BstNI	CCWGG	1 cut(s)	95
BstSCI	CCNGG	1 cut(s)	93
BstV2I	GAAGAC	2 cut(s)	162, 215
BstXI	CCANNNNNNTGG	1 cut(s)	391
BsuRI	GGCC	2 cut(s)	223, 553
BtsCI	GGATG	1 cut(s)	467
BtsIMutI	CAGTG	2 cut(s)	406, 523
Cfr13I	GGNCC	2 cut(s)	394, 551
Csp6I	GTAC	1 cut(s)	409
CviJI	RGCY	8 cut(s)	128, 194, 223, 257, 300, 320, 470, 553
CviKI_1	RGCY	8 cut(s)	128, 194, 223, 257, 300, 320, 470, 553
CviQI	GTAC	1 cut(s)	409
DdeI	CTNAG	2 cut(s)	225, 534
DpnI	GATC	3 cut(s)	99, 120, 442
DpnII	GATC	3 cut(s)	97, 118, 440
DraI	TTTAAA	1 cut(s)	435
DrdI	GACNNNNNNGTC	1 cut(s)	164
DseDI	GACNNNNNNGTC	1 cut(s)	164
Eam1104I	CTCTTC	1 cut(s)	381
EarI	CTCTTC	1 cut(s)	381
Eco147I	AGGCCT	1 cut(s)	223
Eco31I	GGTCTC	1 cut(s)	240
Eco47I	GGWCC	1 cut(s)	394
Eco57I	CTGAAG	1 cut(s)	273
EcoRII	CCWGG	1 cut(s)	93
FalI	AAGNNNNNCTT	4 cut(s)	35, 67, 246, 278
FauNDI	CATATG	1 cut(s)	144
FbaI	TGATCA	1 cut(s)	118
FokI	GGATG	1 cut(s)	474
FspBI	CTAG	1 cut(s)	276
HaeIII	GGCC	2 cut(s)	223, 553
HincII	GTYRAC	1 cut(s)	514
HindII	GTYRAC	1 cut(s)	514
HinfI	GANTC	2 cut(s)	77, 139
Hpy166II	GTNNAC	3 cut(s)	397, 494, 514
Hpy188I	TCNGA	2 cut(s)	76, 429
Hpy188III	TCNNGA	1 cut(s)	459
Hpy8I	GTNNAC	3 cut(s)	397, 494, 514
HpyCH4III	ACNGT	2 cut(s)	401, 518
HpyCH4IV	ACGT	1 cut(s)	289
HpyCH4V	TGCA	1 cut(s)	454
HpyF10VI	GCNNNNNNNGC	1 cut(s)	476
HpyF3I	CTNAG	2 cut(s)	225, 534
HpySE526I	ACGT	1 cut(s)	289
Ksp22I	TGATCA	1 cut(s)	118
Kzo9I	GATC	3 cut(s)	97, 118, 440
LpnPI	CCDG	7 cut(s)	80, 107, 205, 237, 321, 444, 464
MaeI	CTAG	1 cut(s)	276
MaeII	ACGT	1 cut(s)	289
MaeIII	GTNAC	1 cut(s)	500
MalI	GATC	3 cut(s)	99, 120, 442
MboI	GATC	3 cut(s)	97, 118, 440
MboII	GAAGA	4 cut(s)	167, 167, 220, 368
MluCI	AATT	5 cut(s)	108, 162, 385, 430, 526
MmeI	TCCRAC	1 cut(s)	404
MnlI	CCTC	3 cut(s)	22, 423, 482
MseI	TTAA	4 cut(s)	27, 230, 330, 434
MspR9I	CCNGG	1 cut(s)	95
Mva1269I	GAATGC	1 cut(s)	454
MvaI	CCWGG	1 cut(s)	95
MwoI	GCNNNNNNNGC	1 cut(s)	476
NdeI	CATATG	1 cut(s)	144
NdeII	GATC	3 cut(s)	97, 118, 440
PceI	AGGCCT	1 cut(s)	223
PctI	GAATGC	1 cut(s)	454
PfeI	GAWTC	2 cut(s)	77, 139
Psp6I	CCWGG	1 cut(s)	93
PspGI	CCWGG	1 cut(s)	93
PspPI	GGNCC	2 cut(s)	394, 551
RsaI	GTAC	1 cut(s)	410
RsaNI	GTAC	1 cut(s)	409
SaqAI	TTAA	4 cut(s)	27, 230, 330, 434
Sau3AI	GATC	3 cut(s)	97, 118, 440
Sau96I	GGNCC	2 cut(s)	394, 551
ScrFI	CCNGG	1 cut(s)	95
SetI	ASST	7 cut(s)	8, 96, 236, 259, 292, 346, 493
SinI	GGWCC	1 cut(s)	394
SmiI	ATTTAAAT	1 cut(s)	435
SpeI	ACTAGT	1 cut(s)	275
Sse9I	AATT	5 cut(s)	108, 162, 385, 430, 526
SseBI	AGGCCT	1 cut(s)	223
SspMI	CTAG	1 cut(s)	276
StuI	AGGCCT	1 cut(s)	223
StyD4I	CCNGG	1 cut(s)	93
SwaI	ATTTAAAT	1 cut(s)	435
TaaI	ACNGT	2 cut(s)	401, 518
TaiI	ACGT	1 cut(s)	292
TaqI	TCGA	1 cut(s)	100
TasI	AATT	5 cut(s)	108, 162, 385, 430, 526
TfiI	GAWTC	2 cut(s)	77, 139
Tru1I	TTAA	4 cut(s)	27, 230, 330, 434
Tru9I	TTAA	4 cut(s)	27, 230, 330, 434
TscAI	CASTG	2 cut(s)	406, 523
TspDTI	ATGAA	3 cut(s)	131, 168, 221
TspRI	CASTG	2 cut(s)	406, 523
VpaK11BI	GGWCC	1 cut(s)	394
XapI	RAATTY	1 cut(s)	430
XspI	CTAG	1 cut(s)	276

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.