Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013146.1

Orthogroup ID

OG0001340

Physical Location & Seq

Genomic Coordinates Reverse (-)

12193 .. 12984

Gene Structure 792 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013146.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 792 bp

atgttaagaggttgtggcctaatgaaatatgtcgatggatcatttccttgtccttcacaatacatgatcacagaagaaggtggtatcttgtctgaaatgacagcagagtaccttagttggaaacaaaatgattatgctgttatgactttgcttgctgctactctatccagtggtgttctttcttttgttgttggcagtaacacttttagagaactttggtgtttgcttaaagagaggtatgcctctacttcttggtttaacaaaaagcaactaaagagcaacttttacaaacttcaaaaagggtcagattctattgacaactacctggatcgagtgaaaattgcttgtgatcagttggctaatgtagggattcatatgacagatgaagacataattgtctctgttcttcttggtttgccatcagcctatactactatgaagactataatcaggcctgagttaaggtctcttttgctcattgctgaagctgaacttggtttgcctactagtttgtctcaacgtgttgttggcttcaatcctgttagtttggctatgccttttaactgctctacacctactaacacaagcatatataatatgccaactcttccaaccaattatgtggtccacagtgttgcgtaccctcaatatcttgctctgaatttaaatggatcatttaccctgcattctggatgtgtggctcagaatgctcaacatggaggttcacatagtaactttagtgtcaacagtggaagcaatttgtctaagcaatcctacattgggcctcaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 gag_pre-integrs

Protein Analysis

263

Amino Acids

28.91

Weight (kDa)

6.94

Isoelectric Point (pI)

39.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001340)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g05651 FvH4_5g06481
malus_domestica	MD04G1150100.v1.1
rosa_chinensis	RchiOBHm_Chr1g0366871 RchiOBHm_Chr2g0112811 RchiOBHm_Chr5g0022021 RchiOBHm_Chr5g0050161 RchiOBHm_Chr7g0178931
rosa_laevigata	RLG00000030270 RLG00000030274 RLG00000030285 RLG00000030289
rosa_multiflora	Rmu_sc0000206.1_g000011 Rmu_sc0000539.1_g000041 Rmu_sc0001706.1_g000020 Rmu_sc0002245.1_g000029 Rmu_sc0002935.1_g000016 Rmu_sc0002952.1_g000016 Rmu_sc0002952.1_g000017 Rmu_sc0003371.1_g000005 Rmu_sc0004193.1_g000005 Rmu_sc0004359.1_g000018 Rmu_sc0006422.1_g000014 Rmu_sc0007594.1_g000001 Rmu_sc0010925.1_g000018 Rmu_sc0013146.1_g000003 Rmu_sc0031630.1_g000002 Rmu_sc0033466.1_g000001 Rmu_ssc0000079.1_g000006 Rmu_ssc0000423.1_g000006
rosa_roxburghii	Rroxscaffold_1G00004520 Rroxscaffold_1G00005520 Rroxscaffold_1G00041540 Rroxscaffold_1G00045310 Rroxscaffold_5G00361650 Rroxscaffold_6G00388920 Rroxscaffold_6G00405980 Rroxscaffold_6G00410140 Rroxscaffold_6G00423840 Rroxscaffold_7G00200050
rosa_rugosa	Rorug02G0433500 Rorug02G0433600 Rorug02G0433600 Rorug02G0433700 Rorug04G0166100.1 Rorug05G0053500 Rorug06G0481300
rosa_samantha	Rh1CG036200 Rh4AG051700 Rh4BG049000 Rh4CG055700
rosa_wichuraiana	Rw0G022690 Rw1G035930 Rw4G004120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	395
AclWI	GGATC	3 cut(s)	46, 336, 679
AcsI	RAATTY	1 cut(s)	661
AcuI	CTGAAG	1 cut(s)	504
AfaI	GTAC	2 cut(s)	110, 641
AfiI	CCNNNNNNNGG	1 cut(s)	780
AflIII	ACRYGT	1 cut(s)	520
AgsI	TTSAA	2 cut(s)	296, 535
AhlI	ACTAGT	1 cut(s)	506
AjnI	CCWGG	1 cut(s)	324
AjuI	GAANNNNNNNTTGG	2 cut(s)	477, 509
AluBI	AGCT	1 cut(s)	488
AluI	AGCT	1 cut(s)	488
Alw26I	GTCTC	3 cut(s)	403, 471, 519
AlwI	GGATC	3 cut(s)	46, 336, 679
AoxI	GGCC	3 cut(s)	16, 452, 782
ApeKI	GCWGC	1 cut(s)	155
ApoI	RAATTY	1 cut(s)	661
AspS9I	GGNCC	2 cut(s)	625, 782
AvaII	GGWCC	1 cut(s)	625
BbsI	GAAGAC	2 cut(s)	393, 446
BbvI	GCAGC	1 cut(s)	142
BccI	CCATC	2 cut(s)	29, 427
BciT130I	CCWGG	1 cut(s)	326
BclI	TGATCA	2 cut(s)	66, 349
BcoDI	GTCTC	3 cut(s)	403, 471, 519
BcuI	ACTAGT	1 cut(s)	506
BfaI	CTAG	1 cut(s)	507
BisI	GCNGC	1 cut(s)	156
BlsI	GCNGC	1 cut(s)	157
Bme1390I	CCNGG	1 cut(s)	326
Bme18I	GGWCC	1 cut(s)	625
BmgT120I	GGNCC	2 cut(s)	625, 782
BmrFI	CCNGG	1 cut(s)	326
BpiI	GAAGAC	2 cut(s)	393, 446
BsaI	GGTCTC	1 cut(s)	471
Bsc4I	CCNNNNNNNGG	1 cut(s)	780
Bse1I	ACTGG	1 cut(s)	168
Bse3DI	GCAATG	1 cut(s)	477
BseBI	CCWGG	1 cut(s)	326
BseGI	GGATG	1 cut(s)	698
BseLI	CCNNNNNNNGG	1 cut(s)	780
BseMI	GCAATG	1 cut(s)	477
BseMII	CTCAG	2 cut(s)	447, 716
BseNI	ACTGG	1 cut(s)	168
BseXI	GCAGC	1 cut(s)	142
BshFI	GGCC	3 cut(s)	18, 454, 784
BslI	CCNNNNNNNGG	1 cut(s)	780
BsmAI	GTCTC	3 cut(s)	403, 471, 519
BsmI	GAATGC	2 cut(s)	685, 712
BsnI	GGCC	3 cut(s)	18, 454, 784
Bso31I	GGTCTC	1 cut(s)	471
Bsp143I	GATC	5 cut(s)	38, 66, 328, 349, 671
BspANI	GGCC	3 cut(s)	18, 454, 784
BspCNI	CTCAG	2 cut(s)	448, 715
BspPI	GGATC	3 cut(s)	46, 336, 679
BspTNI	GGTCTC	1 cut(s)	471
BsrDI	GCAATG	1 cut(s)	477
BsrI	ACTGG	1 cut(s)	168
BssMI	GATC	5 cut(s)	38, 66, 328, 349, 671
Bst2UI	CCWGG	1 cut(s)	326
Bst4CI	ACNGT	2 cut(s)	632, 749
Bst6I	CTCTTC	1 cut(s)	612
BstC8I	GCNNGC	1 cut(s)	153
BstDEI	CTNAG	4 cut(s)	113, 456, 702, 765
BstF5I	GGATG	1 cut(s)	698
BstKTI	GATC	5 cut(s)	41, 69, 331, 352, 674
BstMAI	GTCTC	3 cut(s)	403, 471, 519
BstMBI	GATC	5 cut(s)	38, 66, 328, 349, 671
BstMWI	GCNNNNNNNGC	1 cut(s)	707
BstNI	CCWGG	1 cut(s)	326
BstSCI	CCNGG	1 cut(s)	324
BstV1I	GCAGC	1 cut(s)	142
BstV2I	GAAGAC	2 cut(s)	393, 446
BstXI	CCANNNNNNTGG	1 cut(s)	622
BsuRI	GGCC	3 cut(s)	18, 454, 784
BtsCI	GGATG	1 cut(s)	698
BtsIMutI	CAGTG	3 cut(s)	175, 637, 754
Cac8I	GCNNGC	1 cut(s)	153
Cfr13I	GGNCC	2 cut(s)	625, 782
Csp6I	GTAC	2 cut(s)	109, 640
CviAII	CATG	2 cut(s)	64, 716
CviJI	RGCY	9 cut(s)	18, 359, 425, 454, 488, 531, 551, 701, 784
CviKI_1	RGCY	9 cut(s)	18, 359, 425, 454, 488, 531, 551, 701, 784
CviQI	GTAC	2 cut(s)	109, 640
DdeI	CTNAG	4 cut(s)	113, 456, 702, 765
DpnI	GATC	5 cut(s)	40, 68, 330, 351, 673
DpnII	GATC	5 cut(s)	38, 66, 328, 349, 671
DraI	TTTAAA	1 cut(s)	666
DrdI	GACNNNNNNGTC	1 cut(s)	395
DseDI	GACNNNNNNGTC	1 cut(s)	395
Eam1104I	CTCTTC	1 cut(s)	612
EarI	CTCTTC	1 cut(s)	612
Eco147I	AGGCCT	1 cut(s)	454
Eco31I	GGTCTC	1 cut(s)	471
Eco47I	GGWCC	1 cut(s)	625
Eco57I	CTGAAG	1 cut(s)	504
EcoRII	CCWGG	1 cut(s)	324
FaeI	CATG	2 cut(s)	67, 719
FalI	AAGNNNNNCTT	4 cut(s)	266, 298, 477, 509
FatI	CATG	2 cut(s)	63, 715
FauNDI	CATATG	1 cut(s)	375
FbaI	TGATCA	2 cut(s)	66, 349
Fnu4HI	GCNGC	1 cut(s)	156
FokI	GGATG	1 cut(s)	705
Fsp4HI	GCNGC	1 cut(s)	156
FspBI	CTAG	1 cut(s)	507
GluI	GCNGC	1 cut(s)	156
HaeIII	GGCC	3 cut(s)	18, 454, 784
Hin1II	CATG	2 cut(s)	67, 719
HincII	GTYRAC	1 cut(s)	745
HindII	GTYRAC	1 cut(s)	745
HinfI	GANTC	2 cut(s)	308, 370
Hpy166II	GTNNAC	3 cut(s)	628, 725, 745
Hpy188I	TCNGA	4 cut(s)	94, 307, 660, 705
Hpy188III	TCNNGA	1 cut(s)	690
Hpy8I	GTNNAC	3 cut(s)	628, 725, 745
HpyAV	CCTTC	2 cut(s)	63, 71
HpyCH4III	ACNGT	2 cut(s)	632, 749
HpyCH4IV	ACGT	1 cut(s)	520
HpyCH4V	TGCA	1 cut(s)	685
HpyF10VI	GCNNNNNNNGC	1 cut(s)	707
HpyF3I	CTNAG	4 cut(s)	113, 456, 702, 765
HpySE526I	ACGT	1 cut(s)	520
Hsp92II	CATG	2 cut(s)	67, 719
Ksp22I	TGATCA	2 cut(s)	66, 349
Kzo9I	GATC	5 cut(s)	38, 66, 328, 349, 671
LpnPI	CCDG	8 cut(s)	181, 311, 338, 436, 468, 552, 675, 695
Lsp1109I	GCAGC	1 cut(s)	142
MaeI	CTAG	1 cut(s)	507
MaeII	ACGT	1 cut(s)	520
MaeIII	GTNAC	2 cut(s)	197, 731
MalI	GATC	5 cut(s)	40, 68, 330, 351, 673
MboI	GATC	5 cut(s)	38, 66, 328, 349, 671
MboII	GAAGA	5 cut(s)	86, 398, 398, 451, 599
MluCI	AATT	5 cut(s)	339, 393, 616, 661, 757
MmeI	TCCRAC	2 cut(s)	98, 635
MnlI	CCTC	4 cut(s)	228, 253, 654, 713
MseI	TTAA	6 cut(s)	5, 228, 258, 461, 561, 665
MspR9I	CCNGG	1 cut(s)	326
Mva1269I	GAATGC	2 cut(s)	685, 712
MvaI	CCWGG	1 cut(s)	326
MwoI	GCNNNNNNNGC	1 cut(s)	707
NdeI	CATATG	1 cut(s)	375
NdeII	GATC	5 cut(s)	38, 66, 328, 349, 671
NlaIII	CATG	2 cut(s)	67, 719
PceI	AGGCCT	1 cut(s)	454
PctI	GAATGC	2 cut(s)	685, 712
PfeI	GAWTC	2 cut(s)	308, 370
PkrI	GCNGC	1 cut(s)	157
Psp6I	CCWGG	1 cut(s)	324
PspGI	CCWGG	1 cut(s)	324
PspPI	GGNCC	2 cut(s)	625, 782
RsaI	GTAC	2 cut(s)	110, 641
RsaNI	GTAC	2 cut(s)	109, 640
SaqAI	TTAA	6 cut(s)	5, 228, 258, 461, 561, 665
SatI	GCNGC	1 cut(s)	156
Sau3AI	GATC	5 cut(s)	38, 66, 328, 349, 671
Sau96I	GGNCC	2 cut(s)	625, 782
ScrFI	CCNGG	1 cut(s)	326
SinI	GGWCC	1 cut(s)	625
SmiI	ATTTAAAT	1 cut(s)	666
SpeI	ACTAGT	1 cut(s)	506
Sse9I	AATT	5 cut(s)	339, 393, 616, 661, 757
SseBI	AGGCCT	1 cut(s)	454
SspMI	CTAG	1 cut(s)	507
StuI	AGGCCT	1 cut(s)	454
StyD4I	CCNGG	1 cut(s)	324
SwaI	ATTTAAAT	1 cut(s)	666
TaaI	ACNGT	2 cut(s)	632, 749
TaiI	ACGT	1 cut(s)	523
TaqI	TCGA	2 cut(s)	33, 331
TasI	AATT	5 cut(s)	339, 393, 616, 661, 757
TfiI	GAWTC	2 cut(s)	308, 370
Tru1I	TTAA	6 cut(s)	5, 228, 258, 461, 561, 665
Tru9I	TTAA	6 cut(s)	5, 228, 258, 461, 561, 665
TscAI	CASTG	3 cut(s)	175, 637, 754
TseI	GCWGC	1 cut(s)	155
TspDTI	ATGAA	4 cut(s)	38, 362, 399, 452
TspRI	CASTG	3 cut(s)	175, 637, 754
VpaK11BI	GGWCC	1 cut(s)	625
XapI	RAATTY	1 cut(s)	661
XspI	CTAG	1 cut(s)	507

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.