Rw0G022690

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig01055
Physical Location & Seq
Forward (+)
17435 .. 17957
523 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G022690.1

Sequence Viewer

Length: 378 bp
ATGCCTACAACTAGTGTTTCTTCTTCTATTGGACACACTGAACAGTCCATGTGTAATTCAAGGTATAAGATGAGGGATGTTCCTCCTCCTGTGTCTAATAGAATCTGCTATGCCACTGCATCTGTTCCTAGAGTGAATTCTACATATGCTGCAAATACTGTTATACAAGATGCGAGTTCCATTATGCAATCTATGCGCAACAATGATGCCATATTCAAACAATGGTTTATACAACCACATGAAGATGCTCGATATGCTTACAATAGTGGTCGAATTCAGTACAATGAAGCATTCAATTCTGGTGCAAAACAGGGATTTGTACCAACCCAGGTTACCAGATATAACACATTCATAAACACTAAAAGACACAATCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

14.18

Weight (kDa)

9.64

Isoelectric Point (pI)

52.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 197
AcsI RAATTY 2 cut(s) 136, 273
AfaI GTAC 2 cut(s) 281, 321
AgsI TTSAA 3 cut(s) 60, 217, 295
AhlI ACTAGT 1 cut(s) 11
AjnI CCWGG 1 cut(s) 327
ApeKI GCWGC 1 cut(s) 149
ApoI RAATTY 2 cut(s) 136, 273
AspLEI GCGC 1 cut(s) 198
BbvI GCAGC 1 cut(s) 136
BciT130I CCWGG 1 cut(s) 329
BcuI ACTAGT 1 cut(s) 11
BfaI CTAG 2 cut(s) 12, 129
BisI GCNGC 1 cut(s) 150
BlsI GCNGC 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 329
BmrFI CCNGG 1 cut(s) 329
BmsI GCATC 4 cut(s) 128, 160, 196, 235
BsaJI CCNNGG 1 cut(s) 327
BseBI CCWGG 1 cut(s) 329
BseDI CCNNGG 1 cut(s) 327
BseGI GGATG 1 cut(s) 82
BseRI GAGGAG 1 cut(s) 75
BseXI GCAGC 1 cut(s) 136
BsmI GAATGC 1 cut(s) 290
BssECI CCNNGG 1 cut(s) 327
Bst2UI CCWGG 1 cut(s) 329
Bst4CI ACNGT 2 cut(s) 45, 160
BstAPI GCANNNNNTGC 1 cut(s) 193
BstEII GGTNACC 1 cut(s) 331
BstF5I GGATG 1 cut(s) 82
BstHHI GCGC 1 cut(s) 198
BstMWI GCNNNNNNNGC 2 cut(s) 193, 254
BstNI CCWGG 1 cut(s) 329
BstPI GGTNACC 1 cut(s) 331
BstSCI CCNGG 1 cut(s) 327
BstV1I GCAGC 1 cut(s) 136
BtsCI GGATG 1 cut(s) 82
BtsI GCAGTG 1 cut(s) 114
BtsIMutI CAGTG 2 cut(s) 36, 114
CfoI GCGC 1 cut(s) 198
Csp6I GTAC 2 cut(s) 280, 320
CviAII CATG 2 cut(s) 49, 239
CviQI GTAC 2 cut(s) 280, 320
Eco91I GGTNACC 1 cut(s) 331
EcoO65I GGTNACC 1 cut(s) 331
EcoRI GAATTC 2 cut(s) 136, 273
EcoRII CCWGG 1 cut(s) 327
FaeI CATG 2 cut(s) 52, 242
FatI CATG 2 cut(s) 48, 238
FauNDI CATATG 1 cut(s) 145
Fnu4HI GCNGC 1 cut(s) 150
FokI GGATG 1 cut(s) 89
Fsp4HI GCNGC 1 cut(s) 150
FspBI CTAG 2 cut(s) 12, 129
FspI TGCGCA 1 cut(s) 197
GlaI GCGC 1 cut(s) 197
GluI GCNGC 1 cut(s) 150
HhaI GCGC 1 cut(s) 198
Hin1II CATG 2 cut(s) 52, 242
Hin6I GCGC 1 cut(s) 196
HinP1I GCGC 1 cut(s) 196
HinfI GANTC 1 cut(s) 102
HpyCH4III ACNGT 2 cut(s) 45, 160
HpyCH4V TGCA 4 cut(s) 119, 152, 187, 305
HpyF10VI GCNNNNNNNGC 2 cut(s) 193, 254
Hsp92II CATG 2 cut(s) 52, 242
HspAI GCGC 1 cut(s) 196
LpnPI CCDG 6 cut(s) 102, 285, 296, 314, 341, 349
Lsp1109I GCAGC 1 cut(s) 136
LweI GCATC 4 cut(s) 128, 160, 196, 235
MaeI CTAG 2 cut(s) 12, 129
MaeIII GTNAC 1 cut(s) 331
MboII GAAGA 3 cut(s) 12, 15, 254
MluCI AATT 4 cut(s) 55, 136, 273, 295
MnlI CCTC 3 cut(s) 66, 93, 96
MseI TTAA 1 cut(s) 376
MslI CAYNNNNRTG 1 cut(s) 243
MspR9I CCNGG 1 cut(s) 329
Mva1269I GAATGC 1 cut(s) 290
MvaI CCWGG 1 cut(s) 329
MwoI GCNNNNNNNGC 2 cut(s) 193, 254
NdeI CATATG 1 cut(s) 145
NlaIII CATG 2 cut(s) 52, 242
NsbI TGCGCA 1 cut(s) 197
PctI GAATGC 1 cut(s) 290
PfeI GAWTC 1 cut(s) 102
PkrI GCNGC 1 cut(s) 151
Psp6I CCWGG 1 cut(s) 327
PspEI GGTNACC 1 cut(s) 331
PspGI CCWGG 1 cut(s) 327
RsaI GTAC 2 cut(s) 281, 321
RsaNI GTAC 2 cut(s) 280, 320
RseI CAYNNNNRTG 1 cut(s) 243
SaqAI TTAA 1 cut(s) 376
SatI GCNGC 1 cut(s) 150
ScrFI CCNGG 1 cut(s) 329
SetI ASST 2 cut(s) 65, 333
SfaNI GCATC 4 cut(s) 128, 160, 196, 235
SmiMI CAYNNNNRTG 1 cut(s) 243
SpeI ACTAGT 1 cut(s) 11
Sse9I AATT 4 cut(s) 55, 136, 273, 295
SspMI CTAG 2 cut(s) 12, 129
StyD4I CCNGG 1 cut(s) 327
TaaI ACNGT 2 cut(s) 45, 160
TaqI TCGA 2 cut(s) 250, 271
TasI AATT 4 cut(s) 55, 136, 273, 295
TatI WGTACW 1 cut(s) 279
TfiI GAWTC 1 cut(s) 102
Tru1I TTAA 1 cut(s) 376
Tru9I TTAA 1 cut(s) 376
TscAI CASTG 2 cut(s) 43, 121
TseI GCWGC 1 cut(s) 149
TspDTI ATGAA 3 cut(s) 255, 300, 340
TspRI CASTG 2 cut(s) 43, 121
XapI RAATTY 2 cut(s) 136, 273
XspI CTAG 2 cut(s) 12, 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.