Rmu_ssc0000423.1_g000006
NAC Family

Chromatin structure-remodeling complex protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000423.1
OG0001340
Physical Location & Seq
Reverse (-)
33223 .. 34712
1490 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000423.1_g000006.1.cds

Sequence Viewer

Length: 1104 bp
atgaatcgaaaggatatattaaaaaagccaccaccaagaggaagaggggagagagttctgtacccacaggatcacaacttgacaacccgccaaaatcttgatactatagacattgtggttcgtacgaggaagggaaagatgagcaaagatttttcaattgaaggtggtgaaaatgctaattttaatattgttcccagtagtggtcaaatggagcactttacttcactatctggaagcatgagaccaatggttagagtcaagcaagaagggcaacatgtgatagaaaggcagatggcaatttggtgtctcgggctgcgagttcaaaacaccgttaagaacttgaagtttccactcagcagcatgctagttccctacctcctacaaatgacattatgggtgtgtggagtcaaactaaacctgggtttccctatgaacagtctcaagtgcccaggatctcttctgaaagctaaagctggtgatgtctctgacgtttgtgagacattgacagaagttgtacctgaaaacatggatttgctgccatcttcaacagggcagaagtcggaatcagaagctatatttggagttgcttctcaggagttggaatctgaagaagttgatgggtctcaggtttgtgagacactgttggaatttgtacctgagaacatggatttgcagccatcttcaacagtgcaggagtcggaatctgaaactagaggtggtgaggcttctcaggttagcaaaacattgccggagtctgaaaacatggatttgcatacattggcaacagcatgtgactcagtatctgcagctaaagctggtgatgcttctggggtttgtgagacattgctggagtccaaaatcatggatttgcaaccaacttcaacagtccaagatacacaatctttaactaaagttagtgatgattctcaggtttgtgagacattgctggagtctgaaaacatggatttgcagccatcttcaactgtacaggagtctgaagctgaagctaacgtttctgtgtcttttgggagagaaggtagtgtttcccccggtgtacctgtatcactaagggcacgtttacttacttggaaggaaagggaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000003 GO:0000166 GO:0000228 GO:0000785 GO:0000790 GO:0000988 GO:0000990 GO:0000991 GO:0002831 GO:0003006 GO:0003674 GO:0003676 GO:0003677 GO:0003678 GO:0003824 GO:0004003 GO:0004386 GO:0005488 GO:0005524 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005694 GO:0005737 GO:0005829 GO:0006139 GO:0006325 GO:0006338 GO:0006351 GO:0006355 GO:0006357 GO:0006366 GO:0006725 GO:0006807 GO:0006950 GO:0006996 GO:0007275 GO:0008026 GO:0008094 GO:0008144 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009611 GO:0009653 GO:0009791 GO:0009889 GO:0009908 GO:0009966 GO:0009987 GO:0010104 GO:0010199 GO:0010467 GO:0010468 GO:0010556 GO:0010646 GO:0010959 GO:0016043 GO:0016070 GO:0016462 GO:0016514 GO:0016586 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017076 GO:0017111 GO:0018130 GO:0019219 GO:0019222 GO:0019438 GO:0022414 GO:0023051 GO:0030554 GO:0031323 GO:0031326 GO:0031347 GO:0031974 GO:0031981 GO:0032101 GO:0032392 GO:0032501 GO:0032502 GO:0032508 GO:0032553 GO:0032555 GO:0032559 GO:0032774 GO:0032879 GO:0032991 GO:0034641 GO:0034645 GO:0034654 GO:0034756 GO:0035639 GO:0036094 GO:0040029 GO:0042623 GO:0043044 GO:0043167 GO:0043168 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043269 GO:0043900 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044271 GO:0044422 GO:0044424 GO:0044427 GO:0044428 GO:0044444 GO:0044446 GO:0044454 GO:0044464 GO:0046483 GO:0048367 GO:0048583 GO:0048608 GO:0048646 GO:0048731 GO:0048856 GO:0048859 GO:0050789 GO:0050794 GO:0050896 GO:0051049 GO:0051171 GO:0051252 GO:0051276 GO:0060255 GO:0061458 GO:0065007 GO:0070013 GO:0070035 GO:0070297 GO:0070603 GO:0071103 GO:0071704 GO:0071840 GO:0080090 GO:0080134 GO:0090304 GO:0090567 GO:0090691 GO:0097159 GO:0097367 GO:0097659 GO:0140097 GO:0140110 GO:1900150 GO:1900390 GO:1900393 GO:1900400 GO:1901265 GO:1901360 GO:1901362 GO:1901363 GO:1901576 GO:1902494 GO:1902531 GO:1903506 GO:1904949 GO:2000022 GO:2000112 GO:2001141
KEGG Pathways
Metabolic & Signaling
ko04714 ko05225 map04714 map05225
Pfam Domains
Protein Families
Helicase_C SNF2_N SnAC

Protein Analysis

367

Amino Acids

40.14

Weight (kDa)

4.79

Isoelectric Point (pI)

51.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 88
AclI AACGTT 1 cut(s) 1011
AclWI GGATC 2 cut(s) 78, 460
AcsI RAATTY 1 cut(s) 647
AcuI CTGAAG 3 cut(s) 627, 1017, 1023
AfaI GTAC 6 cut(s) 62, 124, 516, 654, 987, 1056
AfiI CCNNNNNNNGG 2 cut(s) 38, 200
AflIII ACRYGT 1 cut(s) 274
AgsI TTSAA 8 cut(s) 156, 161, 323, 343, 546, 684, 882, 981
AjnI CCWGG 2 cut(s) 417, 448
AjuI GAANNNNNNNTTGG 2 cut(s) 561, 593
AluBI AGCT 7 cut(s) 467, 473, 572, 809, 815, 1001, 1007
AluI AGCT 7 cut(s) 467, 473, 572, 809, 815, 1001, 1007
Alw21I GWGCWC 1 cut(s) 216
Alw26I GTCTC 9 cut(s) 235, 311, 443, 487, 491, 627, 629, 833, 932
AlwI GGATC 2 cut(s) 78, 460
AlwNI CAGNNNCTG 1 cut(s) 803
Ama87I CYCGRG 1 cut(s) 308
ApeKI GCWGC 6 cut(s) 313, 357, 535, 673, 806, 970
ApoI RAATTY 1 cut(s) 647
AsuC2I CCSGG 1 cut(s) 1050
AsuHPI GGTGA 4 cut(s) 179, 488, 731, 830
AvaI CYCGRG 1 cut(s) 308
BaeGI GKGCMC 2 cut(s) 449, 1075
Bbv12I GWGCWC 1 cut(s) 216
BbvI GCAGC 6 cut(s) 300, 369, 522, 685, 818, 982
BccI CCATC 5 cut(s) 286, 547, 611, 685, 982
BciT130I CCWGG 2 cut(s) 419, 450
BcnI CCSGG 1 cut(s) 1050
BcoDI GTCTC 9 cut(s) 235, 311, 443, 487, 491, 627, 629, 833, 932
BfaI CTAG 2 cut(s) 365, 711
BfmI CTRYAG 2 cut(s) 105, 804
BisI GCNGC 6 cut(s) 314, 358, 536, 674, 807, 971
BlsI GCNGC 6 cut(s) 315, 359, 537, 675, 808, 972
Bme1390I CCNGG 3 cut(s) 419, 450, 1050
BmeT110I CYCGRG 1 cut(s) 308
BmrFI CCNGG 3 cut(s) 419, 450, 1050
BmrI ACTGGG 1 cut(s) 189
BmsI GCATC 1 cut(s) 811
BmuI ACTGGG 1 cut(s) 189
BpmI CTGGAG 2 cut(s) 869, 968
BpuEI CTTGAG 1 cut(s) 425
BpuMI CCSGG 1 cut(s) 1050
BsaI GGTCTC 2 cut(s) 235, 627
BsaJI CCNNGG 3 cut(s) 418, 448, 1048
BsaXI ACNNNNNCTCC 2 cut(s) 1021, 1051
Bsc4I CCNNNNNNNGG 2 cut(s) 38, 200
Bse1I ACTGG 1 cut(s) 195
Bse3DI GCAATG 3 cut(s) 743, 842, 941
BseBI CCWGG 2 cut(s) 419, 450
BseDI CCNNGG 3 cut(s) 418, 448, 1048
BseLI CCNNNNNNNGG 2 cut(s) 38, 200
BseMI GCAATG 3 cut(s) 743, 842, 941
BseMII CTCAG 7 cut(s) 367, 605, 638, 648, 743, 810, 941
BseNI ACTGG 1 cut(s) 195
BseSI GKGCMC 2 cut(s) 449, 1075
BseXI GCAGC 6 cut(s) 300, 369, 522, 685, 818, 982
BsgI GTGCAG 1 cut(s) 710
BsiHKAI GWGCWC 1 cut(s) 216
BsiHKCI CYCGRG 1 cut(s) 308
BsiSI CCGG 2 cut(s) 749, 1050
BsiWI CGTACG 1 cut(s) 122
BslI CCNNNNNNNGG 2 cut(s) 38, 200
BsmAI GTCTC 9 cut(s) 235, 311, 443, 487, 491, 627, 629, 833, 932
Bso31I GGTCTC 2 cut(s) 235, 627
BsoBI CYCGRG 1 cut(s) 308
Bsp1286I GDGCHC 3 cut(s) 216, 449, 1075
Bsp1407I TGTACA 1 cut(s) 985
Bsp143I GATC 2 cut(s) 70, 452
BspACI CCGC 1 cut(s) 88
BspCNI CTCAG 7 cut(s) 366, 604, 637, 649, 742, 809, 940
BspMAI CTGCAG 1 cut(s) 808
BspPI GGATC 2 cut(s) 78, 460
BspTNI GGTCTC 2 cut(s) 235, 627
BsrDI GCAATG 3 cut(s) 743, 842, 941
BsrGI TGTACA 1 cut(s) 985
BsrI ACTGG 1 cut(s) 195
BssECI CCNNGG 3 cut(s) 418, 448, 1048
BssMI GATC 2 cut(s) 70, 452
Bst2UI CCWGG 2 cut(s) 419, 450
Bst4CI ACNGT 6 cut(s) 331, 437, 642, 688, 886, 985
Bst6I CTCTTC 2 cut(s) 37, 462
BstAUI TGTACA 1 cut(s) 985
BstC8I GCNNGC 1 cut(s) 362
BstDEI CTNAG 8 cut(s) 353, 591, 624, 657, 729, 796, 927, 1067
BstKTI GATC 2 cut(s) 73, 455
BstMAI GTCTC 9 cut(s) 235, 311, 443, 487, 491, 627, 629, 833, 932
BstMBI GATC 2 cut(s) 70, 452
BstMWI GCNNNNNNNGC 3 cut(s) 268, 812, 821
BstNI CCWGG 2 cut(s) 419, 450
BstNSI RCATGY 3 cut(s) 278, 364, 792
BstSCI CCNGG 3 cut(s) 417, 448, 1048
BstSFI CTRYAG 2 cut(s) 105, 804
BstSLI GKGCMC 2 cut(s) 449, 1075
BstV1I GCAGC 6 cut(s) 300, 369, 522, 685, 818, 982
BstX2I RGATCY 1 cut(s) 452
BstXI CCANNNNNNTGG 1 cut(s) 862
BstYI RGATCY 1 cut(s) 452
BtsIMutI CAGTG 2 cut(s) 638, 693
Cac8I GCNNGC 1 cut(s) 362
CaiI CAGNNNCTG 1 cut(s) 803
Csp6I GTAC 6 cut(s) 61, 123, 515, 653, 986, 1055
CviAII CATG 9 cut(s) 238, 275, 361, 526, 664, 763, 789, 862, 961
CviQI GTAC 6 cut(s) 61, 123, 515, 653, 986, 1055
DdeI CTNAG 8 cut(s) 353, 591, 624, 657, 729, 796, 927, 1067
DpnI GATC 2 cut(s) 72, 454
DpnII GATC 2 cut(s) 70, 452
Eam1104I CTCTTC 2 cut(s) 37, 462
EarI CTCTTC 2 cut(s) 37, 462
Eco31I GGTCTC 2 cut(s) 235, 627
Eco57I CTGAAG 3 cut(s) 627, 1017, 1023
Eco88I CYCGRG 1 cut(s) 308
EcoRII CCWGG 2 cut(s) 417, 448
FaeI CATG 9 cut(s) 241, 278, 364, 529, 667, 766, 792, 865, 964
FatI CATG 9 cut(s) 237, 274, 360, 525, 663, 762, 788, 861, 960
FauI CCCGC 1 cut(s) 95
Fnu4HI GCNGC 6 cut(s) 314, 358, 536, 674, 807, 971
Fsp4HI GCNGC 6 cut(s) 314, 358, 536, 674, 807, 971
FspBI CTAG 2 cut(s) 365, 711
GluI GCNGC 6 cut(s) 314, 358, 536, 674, 807, 971
GsuI CTGGAG 2 cut(s) 869, 968
HapII CCGG 2 cut(s) 749, 1050
Hin1II CATG 9 cut(s) 241, 278, 364, 529, 667, 766, 792, 865, 964
HpaII CCGG 2 cut(s) 749, 1050
HphI GGTGA 4 cut(s) 179, 488, 731, 830
Hpy166II GTNNAC 2 cut(s) 1055, 1079
Hpy188III TCNNGA 3 cut(s) 98, 231, 593
Hpy8I GTNNAC 2 cut(s) 1055, 1079
HpyAV CCTTC 5 cut(s) 124, 155, 260, 1028, 1084
HpyCH4III ACNGT 6 cut(s) 331, 437, 642, 688, 886, 985
HpyCH4IV ACGT 3 cut(s) 489, 1011, 1075
HpyCH4V TGCA 6 cut(s) 673, 691, 772, 806, 871, 970
HpyF10VI GCNNNNNNNGC 3 cut(s) 268, 812, 821
HpyF3I CTNAG 8 cut(s) 353, 591, 624, 657, 729, 796, 927, 1067
HpySE526I ACGT 3 cut(s) 489, 1011, 1075
Hsp92II CATG 9 cut(s) 241, 278, 364, 529, 667, 766, 792, 865, 964
Kzo9I GATC 2 cut(s) 70, 452
LmnI GCTCC 1 cut(s) 211
Lsp1109I GCAGC 6 cut(s) 300, 369, 522, 685, 818, 982
LweI GCATC 1 cut(s) 811
MaeI CTAG 2 cut(s) 365, 711
MaeII ACGT 3 cut(s) 489, 1011, 1075
MaeIII GTNAC 1 cut(s) 791
MalI GATC 2 cut(s) 72, 454
MboI GATC 2 cut(s) 70, 452
MboII GAAGA 6 cut(s) 54, 449, 534, 620, 672, 969
MfeI CAATTG 1 cut(s) 156
MflI RGATCY 1 cut(s) 452
MhlI GDGCHC 3 cut(s) 216, 449, 1075
MluCI AATT 4 cut(s) 156, 178, 297, 647
MlyI GAGTC 8 cut(s) 264, 414, 704, 761, 788, 860, 959, 1001
MmeI TCCRAC 4 cut(s) 540, 579, 624, 678
MnlI CCTC 6 cut(s) 32, 38, 120, 386, 707, 715
MseI TTAA 4 cut(s) 20, 183, 333, 905
MspI CCGG 2 cut(s) 749, 1050
MspR9I CCNGG 3 cut(s) 419, 450, 1050
MunI CAATTG 1 cut(s) 156
MvaI CCWGG 2 cut(s) 419, 450
MwoI GCNNNNNNNGC 3 cut(s) 268, 812, 821
NciI CCSGG 1 cut(s) 1050
NdeII GATC 2 cut(s) 70, 452
NlaIII CATG 9 cut(s) 241, 278, 364, 529, 667, 766, 792, 865, 964
NmuCI GTSAC 1 cut(s) 791
NspI RCATGY 3 cut(s) 278, 364, 792
PaeI GCATGC 1 cut(s) 364
PciI ACATGT 1 cut(s) 274
PfeI GAWTC 5 cut(s) 4, 563, 602, 701, 923
Pfl23II CGTACG 1 cut(s) 122
PkrI GCNGC 6 cut(s) 315, 359, 537, 675, 808, 972
PleI GAGTC 8 cut(s) 263, 413, 703, 760, 788, 859, 958, 1000
PpsI GAGTC 8 cut(s) 263, 413, 703, 760, 788, 859, 958, 1000
PscI ACATGT 1 cut(s) 274
Psp1406I AACGTT 1 cut(s) 1011
Psp6I CCWGG 2 cut(s) 417, 448
PspGI CCWGG 2 cut(s) 417, 448
PspLI CGTACG 1 cut(s) 122
PstI CTGCAG 1 cut(s) 808
PstNI CAGNNNCTG 1 cut(s) 803
PsuI RGATCY 1 cut(s) 452
RsaI GTAC 6 cut(s) 62, 124, 516, 654, 987, 1056
RsaNI GTAC 6 cut(s) 61, 123, 515, 653, 986, 1055
SaqAI TTAA 4 cut(s) 20, 183, 333, 905
SatI GCNGC 6 cut(s) 314, 358, 536, 674, 807, 971
Sau3AI GATC 2 cut(s) 70, 452
SchI GAGTC 8 cut(s) 264, 414, 704, 761, 788, 860, 959, 1001
ScrFI CCNGG 3 cut(s) 419, 450, 1050
SduI GDGCHC 3 cut(s) 216, 449, 1075
SfaNI GCATC 1 cut(s) 811
SfcI CTRYAG 2 cut(s) 105, 804
SmlI CTYRAG 1 cut(s) 440
SmoI CTYRAG 1 cut(s) 440
SphI GCATGC 1 cut(s) 364
Sse9I AATT 4 cut(s) 156, 178, 297, 647
SsiI CCGC 1 cut(s) 88
SspI AATATT 1 cut(s) 187
SspMI CTAG 2 cut(s) 365, 711
StyD4I CCNGG 3 cut(s) 417, 448, 1048
TaaI ACNGT 6 cut(s) 331, 437, 642, 688, 886, 985
TaiI ACGT 3 cut(s) 492, 1014, 1078
TaqI TCGA 1 cut(s) 7
TasI AATT 4 cut(s) 156, 178, 297, 647
TatI WGTACW 1 cut(s) 985
TfiI GAWTC 5 cut(s) 4, 563, 602, 701, 923
Tru1I TTAA 4 cut(s) 20, 183, 333, 905
Tru9I TTAA 4 cut(s) 20, 183, 333, 905
TscAI CASTG 2 cut(s) 645, 693
TseFI GTSAC 1 cut(s) 791
TseI GCWGC 6 cut(s) 313, 357, 535, 673, 806, 970
Tsp45I GTSAC 1 cut(s) 791
TspDTI ATGAA 2 cut(s) 17, 446
TspRI CASTG 2 cut(s) 645, 693
XapI RAATTY 1 cut(s) 647
XceI RCATGY 3 cut(s) 278, 364, 792
XspI CTAG 2 cut(s) 365, 711
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.