Rmu_sc0002245.1_g000029

GAG-pre-integrase domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002245.1
OG0001340
Physical Location & Seq
Reverse (-)
119559 .. 120584
1026 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002245.1_g000029.1.cds

Sequence Viewer

Length: 786 bp
atgctcaaaagtcttggtttagagggatatattgatggttcatgttcttgtccgcctcaattcttggtatctgatgatgggataaatgctggagttacaagggagtttcaagaatgggaaaagaatgataaagcattgatgactcttatctctgccactttatctagtgaagcattatcatatgtgaaaggtaatgacacaatagacaagtattttcagcgtatcaaggacattactgatcaattagcttctgttggcattcatattcccaatgatgagattattatcattgctgtcaatggtcttccctctgagtacatgactatcaaaatcatgatcaaagctcagatcacaactatgtcaatgaacatattgcgttatcttttacttgatgaggagtctactatggatcaatctctaaagtctacgcaggttccttacacagttgcaatggttcctacatacttggcttctggtataacacagcaacatggtggtcttcaatcacaagtcaatactggacttgctacctctaatcgtgaagtgcagtatagtaagaggttctttcaacccaacaatggctttcattctgagcttcttaatggtttgcctcaaaggggtggacagagagataagttcaatctaggtggtggcaggtactctcatagaagttctccgggttttggtacctatggtatctttggtatttttgctccatatcagtatcatgactatcatcataactatgcaaaaccggaattcaaatactggttatgtgaaatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 gag_pre-integrs rve

Protein Analysis

261

Amino Acids

29.29

Weight (kDa)

5.97

Isoelectric Point (pI)

37.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 421, 645
Acc65I GGTACC 1 cut(s) 686
AccB1I GGYRCC 1 cut(s) 686
AccI GTMKAC 2 cut(s) 401, 425
AciI CCGC 1 cut(s) 53
AclWI GGATC 1 cut(s) 417
AcsI RAATTY 1 cut(s) 758
AfaI GTAC 3 cut(s) 317, 659, 688
AfiI CCNNNNNNNGG 3 cut(s) 578, 617, 683
AgsI TTSAA 5 cut(s) 110, 503, 569, 640, 763
AluBI AGCT 3 cut(s) 248, 344, 595
AluI AGCT 3 cut(s) 248, 344, 595
AlwI GGATC 1 cut(s) 417
ApoI RAATTY 1 cut(s) 758
Asp718I GGTACC 1 cut(s) 686
AsuC2I CCSGG 1 cut(s) 678
BanI GGYRCC 1 cut(s) 686
BbsI GAAGAC 2 cut(s) 296, 491
BccI CCATC 2 cut(s) 29, 71
BclI TGATCA 2 cut(s) 238, 336
BcnI CCSGG 1 cut(s) 678
BfaI CTAG 3 cut(s) 165, 644, 784
BfuAI ACCTGC 2 cut(s) 421, 645
Bme1390I CCNGG 1 cut(s) 678
BmiI GGNNCC 3 cut(s) 435, 456, 688
BmrFI CCNGG 1 cut(s) 678
BpiI GAAGAC 2 cut(s) 296, 491
BpmI CTGGAG 1 cut(s) 111
BpuMI CCSGG 1 cut(s) 678
BsaBI GATNNNNATC 1 cut(s) 284
BsaWI WCCGGW 1 cut(s) 754
Bsc4I CCNNNNNNNGG 3 cut(s) 578, 617, 683
Bse1I ACTGG 2 cut(s) 523, 773
Bse3DI GCAATG 2 cut(s) 288, 456
Bse8I GATNNNNATC 1 cut(s) 284
BseJI GATNNNNATC 1 cut(s) 284
BseLI CCNNNNNNNGG 3 cut(s) 578, 617, 683
BseMI GCAATG 2 cut(s) 288, 456
BseMII CTCAG 3 cut(s) 303, 359, 582
BseNI ACTGG 2 cut(s) 523, 773
BseRI GAGGAG 1 cut(s) 410
BsgI GTGCAG 1 cut(s) 566
BshNI GGYRCC 1 cut(s) 686
BsiSI CCGG 2 cut(s) 677, 755
BslI CCNNNNNNNGG 3 cut(s) 578, 617, 683
BsmI GAATGC 1 cut(s) 258
Bsp143I GATC 4 cut(s) 238, 336, 348, 409
BspACI CCGC 1 cut(s) 53
BspCNI CTCAG 3 cut(s) 304, 358, 583
BspHI TCATGA 2 cut(s) 333, 727
BspLI GGNNCC 3 cut(s) 435, 456, 688
BspMI ACCTGC 2 cut(s) 421, 645
BspPI GGATC 1 cut(s) 417
BspT107I GGYRCC 1 cut(s) 686
BsrDI GCAATG 2 cut(s) 288, 456
BsrI ACTGG 2 cut(s) 523, 773
BssMI GATC 4 cut(s) 238, 336, 348, 409
Bst4CI ACNGT 1 cut(s) 445
BstDEI CTNAG 3 cut(s) 312, 345, 591
BstKTI GATC 4 cut(s) 241, 339, 351, 412
BstMBI GATC 4 cut(s) 238, 336, 348, 409
BstSCI CCNGG 1 cut(s) 676
BstV2I GAAGAC 2 cut(s) 296, 491
BveI ACCTGC 2 cut(s) 421, 645
CciI TCATGA 2 cut(s) 333, 727
Csp6I GTAC 3 cut(s) 316, 658, 687
CspCI CAANNNNNGTGG 2 cut(s) 628, 663
CviAII CATG 5 cut(s) 42, 319, 334, 491, 728
CviJI RGCY 5 cut(s) 248, 344, 470, 582, 595
CviKI_1 RGCY 5 cut(s) 248, 344, 470, 582, 595
CviQI GTAC 3 cut(s) 316, 658, 687
DdeI CTNAG 3 cut(s) 312, 345, 591
DpnI GATC 4 cut(s) 240, 338, 350, 411
DpnII GATC 4 cut(s) 238, 336, 348, 409
EciI GGCGGA 1 cut(s) 42
EcoRI GAATTC 1 cut(s) 758
FaeI CATG 5 cut(s) 45, 322, 337, 494, 731
FalI AAGNNNNNCTT 2 cut(s) 548, 580
FatI CATG 5 cut(s) 41, 318, 333, 490, 727
FauNDI CATATG 1 cut(s) 181
FbaI TGATCA 2 cut(s) 238, 336
FblI GTMKAC 2 cut(s) 401, 425
FspBI CTAG 3 cut(s) 165, 644, 784
GsuI CTGGAG 1 cut(s) 111
HapII CCGG 2 cut(s) 677, 755
Hin1II CATG 5 cut(s) 45, 322, 337, 494, 731
HinfI GANTC 2 cut(s) 142, 398
HpaII CCGG 2 cut(s) 677, 755
Hpy166II GTNNAC 3 cut(s) 402, 426, 623
Hpy188I TCNGA 4 cut(s) 73, 313, 348, 592
Hpy188III TCNNGA 4 cut(s) 110, 334, 539, 728
Hpy8I GTNNAC 3 cut(s) 402, 426, 623
HpyCH4III ACNGT 1 cut(s) 445
HpyCH4V TGCA 3 cut(s) 449, 547, 749
HpyF3I CTNAG 3 cut(s) 312, 345, 591
Hsp92II CATG 5 cut(s) 45, 322, 337, 494, 731
KpnI GGTACC 1 cut(s) 690
Ksp22I TGATCA 2 cut(s) 238, 336
Kzo9I GATC 4 cut(s) 238, 336, 348, 409
LmnI GCTCC 1 cut(s) 718
LpnPI CCDG 8 cut(s) 75, 416, 459, 504, 640, 690, 754, 768
MaeI CTAG 3 cut(s) 165, 644, 784
MaeIII GTNAC 1 cut(s) 94
MalI GATC 4 cut(s) 240, 338, 350, 411
MboI GATC 4 cut(s) 238, 336, 348, 409
MboII GAAGA 2 cut(s) 296, 491
MluCI AATT 3 cut(s) 59, 242, 758
MlyI GAGTC 2 cut(s) 136, 407
MnlI CCTC 7 cut(s) 16, 66, 319, 388, 541, 552, 621
MseI TTAA 1 cut(s) 600
MslI CAYNNNNRTG 2 cut(s) 356, 744
MspI CCGG 2 cut(s) 677, 755
MspR9I CCNGG 1 cut(s) 678
Mva1269I GAATGC 1 cut(s) 258
NciI CCSGG 1 cut(s) 678
NdeI CATATG 1 cut(s) 181
NdeII GATC 4 cut(s) 238, 336, 348, 409
NlaIII CATG 5 cut(s) 45, 322, 337, 494, 731
NlaIV GGNNCC 3 cut(s) 435, 456, 688
PagI TCATGA 2 cut(s) 333, 727
PctI GAATGC 1 cut(s) 258
PleI GAGTC 2 cut(s) 136, 406
PpsI GAGTC 2 cut(s) 136, 406
PspN4I GGNNCC 3 cut(s) 435, 456, 688
RsaI GTAC 3 cut(s) 317, 659, 688
RsaNI GTAC 3 cut(s) 316, 658, 687
RseI CAYNNNNRTG 2 cut(s) 356, 744
SaqAI TTAA 1 cut(s) 600
Sau3AI GATC 4 cut(s) 238, 336, 348, 409
SchI GAGTC 2 cut(s) 136, 407
ScrFI CCNGG 1 cut(s) 678
SmiMI CAYNNNNRTG 2 cut(s) 356, 744
Sse9I AATT 3 cut(s) 59, 242, 758
SsiI CCGC 1 cut(s) 53
SspMI CTAG 3 cut(s) 165, 644, 784
StyD4I CCNGG 1 cut(s) 676
TaaI ACNGT 1 cut(s) 445
TasI AATT 3 cut(s) 59, 242, 758
TatI WGTACW 1 cut(s) 315
Tru1I TTAA 1 cut(s) 600
Tru9I TTAA 1 cut(s) 600
TspDTI ATGAA 4 cut(s) 30, 251, 380, 575
XapI RAATTY 1 cut(s) 758
XmiI GTMKAC 2 cut(s) 401, 425
XspI CTAG 3 cut(s) 165, 644, 784
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.