RchiOBHm_Chr2g0127881

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
42697647 .. 42698284
638 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49970

Sequence Viewer

Length: 165 bp
ATGTTGATCGAGTTTGAGAGCAAGCTTTCAATAGGTGTCAAGCTCTGGGTATGGCAATCTGAACTGTTCAAAGGTGCAATCATTTATCTTTGGGAATTCTATCTCAACCTGGTCGTCTTCTTTACAGTTGAGGTAATCGGCTCTCATTTTTTTAATCTTATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.46

Weight (kDa)

5.01

Isoelectric Point (pI)

34.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 95
AgsI TTSAA 2 cut(s) 30, 70
AjnI CCWGG 1 cut(s) 108
AluBI AGCT 2 cut(s) 25, 43
AluI AGCT 2 cut(s) 25, 43
ApoI RAATTY 1 cut(s) 95
BbsI GAAGAC 1 cut(s) 109
BciT130I CCWGG 1 cut(s) 110
Bme1390I CCNGG 1 cut(s) 110
BmrFI CCNGG 1 cut(s) 110
BpiI GAAGAC 1 cut(s) 109
BseBI CCWGG 1 cut(s) 110
Bsp143I GATC 1 cut(s) 6
BssMI GATC 1 cut(s) 6
Bst2UI CCWGG 1 cut(s) 110
Bst4CI ACNGT 2 cut(s) 66, 127
BstC8I GCNNGC 1 cut(s) 23
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstNI CCWGG 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 108
BstV2I GAAGAC 1 cut(s) 109
Cac8I GCNNGC 1 cut(s) 23
CsiI ACCWGGT 1 cut(s) 108
CviJI RGCY 3 cut(s) 25, 43, 141
CviKI_1 RGCY 3 cut(s) 25, 43, 141
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
EcoRI GAATTC 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 108
FaiI YATR 1 cut(s) 52
HindIII AAGCTT 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 61
HpyCH4III ACNGT 2 cut(s) 66, 127
HpyCH4V TGCA 1 cut(s) 77
Kzo9I GATC 1 cut(s) 6
LpnPI CCDG 3 cut(s) 31, 95, 122
MabI ACCWGGT 1 cut(s) 108
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 1 cut(s) 109
MluCI AATT 1 cut(s) 95
MnlI CCTC 1 cut(s) 124
MseI TTAA 1 cut(s) 153
MspR9I CCNGG 1 cut(s) 110
MvaI CCWGG 1 cut(s) 110
NdeII GATC 1 cut(s) 6
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
SaqAI TTAA 1 cut(s) 153
Sau3AI GATC 1 cut(s) 6
ScrFI CCNGG 1 cut(s) 110
SetI ASST 6 cut(s) 27, 37, 45, 76, 111, 135
SexAI ACCWGGT 1 cut(s) 108
SgeI CNNG 6 cut(s) 22, 34, 52, 58, 121, 122
Sse9I AATT 1 cut(s) 95
StyD4I CCNGG 1 cut(s) 108
TaaI ACNGT 2 cut(s) 66, 127
TaqI TCGA 1 cut(s) 9
TasI AATT 1 cut(s) 95
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
XapI RAATTY 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.