RchiOBHm_Chr4g0394061

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
9726928 .. 9731256
4329 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36659

Sequence Viewer

Length: 147 bp
ATGGGACCAAAACCAATGTTGAGAGGAACAAAGAGGGGAACAAGTGAACAGGCAATTGGGCAAAGAAGAAATAAATCTGATTGTATTTTTTCGGTGGACATCAGTATAATGCGGCTAAATCAAAGAAATCGAAAACAAAGAACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

48

Amino Acids

5.56

Weight (kDa)

11.79

Isoelectric Point (pI)

39.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 112
AjuI GAANNNNNNNTTGG 2 cut(s) 39, 71
AspS9I GGNCC 1 cut(s) 5
AvaII GGWCC 1 cut(s) 5
BisI GCNGC 1 cut(s) 113
BlsI GCNGC 1 cut(s) 114
Bme18I GGWCC 1 cut(s) 5
BmgT120I GGNCC 1 cut(s) 5
BmiI GGNNCC 1 cut(s) 6
BslFI GGGAC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 18
BspACI CCGC 1 cut(s) 112
BspLI GGNNCC 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 5
CviJI RGCY 1 cut(s) 115
CviKI_1 RGCY 1 cut(s) 115
Eco47I GGWCC 1 cut(s) 5
FaiI YATR 1 cut(s) 107
FaqI GGGAC 1 cut(s) 18
Fnu4HI GCNGC 1 cut(s) 113
Fsp4HI GCNGC 1 cut(s) 113
GluI GCNGC 1 cut(s) 113
Hpy166II GTNNAC 2 cut(s) 47, 97
Hpy188I TCNGA 1 cut(s) 79
Hpy8I GTNNAC 2 cut(s) 47, 97
LpnPI CCDG 1 cut(s) 35
MboII GAAGA 1 cut(s) 78
MfeI CAATTG 1 cut(s) 54
MluCI AATT 1 cut(s) 54
MnlI CCTC 2 cut(s) 17, 27
MseI TTAA 1 cut(s) 145
MunI CAATTG 1 cut(s) 54
NlaIV GGNNCC 1 cut(s) 6
PkrI GCNGC 1 cut(s) 114
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 5
SaqAI TTAA 1 cut(s) 145
SatI GCNGC 1 cut(s) 113
Sau96I GGNCC 1 cut(s) 5
SgeI CNNG 2 cut(s) 54, 62
SinI GGWCC 1 cut(s) 5
Sse9I AATT 1 cut(s) 54
SsiI CCGC 1 cut(s) 112
TaqI TCGA 1 cut(s) 130
TasI AATT 1 cut(s) 54
TauI GCSGC 1 cut(s) 115
Tru1I TTAA 1 cut(s) 145
Tru9I TTAA 1 cut(s) 145
VpaK11BI GGWCC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.