Rmu_sc0037818.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037818.1
Physical Location & Seq
Forward (+)
3193 .. 3944
752 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037818.1_g000001.1.cds

Sequence Viewer

Length: 429 bp
atgaaatcctctgtcgcagctgccgctaaggccacgctcaactcgctctgtgtcgcctatgagaacaagaggtacactttttctgtgctactacctctctctccttcctccacgggtccgttagcttttaaattgactggaattaaaggtttatctgaggccaaacttgataagatttgtgacagtgccgagaagatagtggttattgttgataccacttacatactaccaagcataagcaacaacctcgtaggtggtcccgacgacatggttagtctcgcctacaacatgcctccgatagaccgacacccaagctacctcgctatagtggaggtcggccagtatctagctgggaggccaccttcccatgctctccagaagggttcaagagaagcaatatgtgcattgtatcccacatcagaaatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

142

Amino Acids

15.15

Weight (kDa)

7.68

Isoelectric Point (pI)

32.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 24
AcoI YGGCCR 1 cut(s) 337
AfaI GTAC 1 cut(s) 74
AgsI TTSAA 1 cut(s) 387
AluBI AGCT 4 cut(s) 20, 125, 315, 350
AluI AGCT 4 cut(s) 20, 125, 315, 350
Alw26I GTCTC 1 cut(s) 281
AoxI GGCC 4 cut(s) 30, 159, 337, 356
ApeKI GCWGC 2 cut(s) 17, 20
AspS9I GGNCC 2 cut(s) 116, 257
AvaII GGWCC 2 cut(s) 116, 257
BbvI GCAGC 2 cut(s) 7, 29
BcgI CGANNNNNNTGC 2 cut(s) 229, 263
BciVI GTATCC 1 cut(s) 420
BcoDI GTCTC 1 cut(s) 281
BfaI CTAG 1 cut(s) 347
BfmI CTRYAG 1 cut(s) 324
BfuI GTATCC 1 cut(s) 420
BglI GCCNNNNNGGC 1 cut(s) 29
BisI GCNGC 3 cut(s) 18, 21, 24
BlsI GCNGC 3 cut(s) 19, 22, 25
Bme18I GGWCC 2 cut(s) 116, 257
BmgT120I GGNCC 2 cut(s) 116, 257
BmiI GGNNCC 2 cut(s) 117, 259
BpmI CTGGAG 1 cut(s) 359
Bpu10I CCTNAGC 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 111
Bse1I ACTGG 2 cut(s) 142, 340
BseDI CCNNGG 1 cut(s) 111
BseMII CTCAG 1 cut(s) 147
BseNI ACTGG 2 cut(s) 142, 340
BseXI GCAGC 2 cut(s) 7, 29
BseYI CCCAGC 1 cut(s) 350
BshFI GGCC 4 cut(s) 32, 161, 339, 358
BslFI GGGAC 1 cut(s) 243
BsmAI GTCTC 1 cut(s) 281
BsmFI GGGAC 1 cut(s) 243
BsnI GGCC 4 cut(s) 32, 161, 339, 358
BspACI CCGC 1 cut(s) 24
BspANI GGCC 4 cut(s) 32, 161, 339, 358
BspCNI CTCAG 1 cut(s) 148
BspLI GGNNCC 2 cut(s) 117, 259
BsrI ACTGG 2 cut(s) 142, 340
BssECI CCNNGG 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 185
BstAPI GCANNNNNTGC 1 cut(s) 401
BstDEI CTNAG 2 cut(s) 27, 156
BstDSI CCRYGG 1 cut(s) 111
BstMAI GTCTC 1 cut(s) 281
BstMWI GCNNNNNNNGC 4 cut(s) 23, 29, 43, 401
BstNSI RCATGY 1 cut(s) 292
BstSFI CTRYAG 1 cut(s) 324
BstV1I GCAGC 2 cut(s) 7, 29
BsuI GTATCC 1 cut(s) 420
BsuRI GGCC 4 cut(s) 32, 161, 339, 358
BtgI CCRYGG 1 cut(s) 111
BtsIMutI CAGTG 1 cut(s) 190
Cfr13I GGNCC 2 cut(s) 116, 257
Csp6I GTAC 1 cut(s) 73
CviAII CATG 3 cut(s) 268, 289, 368
CviJI RGCY 8 cut(s) 20, 32, 125, 161, 315, 339, 350, 358
CviKI_1 RGCY 8 cut(s) 20, 32, 125, 161, 315, 339, 350, 358
CviQI GTAC 1 cut(s) 73
DdeI CTNAG 2 cut(s) 27, 156
DraI TTTAAA 1 cut(s) 130
EaeI YGGCCR 1 cut(s) 337
Eco47I GGWCC 2 cut(s) 116, 257
FaeI CATG 3 cut(s) 271, 292, 371
FaiI YATR 8 cut(s) 60, 224, 236, 269, 290, 326, 369, 400
FaqI GGGAC 1 cut(s) 243
FatI CATG 3 cut(s) 267, 288, 367
Fnu4HI GCNGC 3 cut(s) 18, 21, 24
Fsp4HI GCNGC 3 cut(s) 18, 21, 24
FspBI CTAG 1 cut(s) 347
GluI GCNGC 3 cut(s) 18, 21, 24
GsaI CCCAGC 1 cut(s) 354
GsuI CTGGAG 1 cut(s) 359
HaeIII GGCC 4 cut(s) 32, 161, 339, 358
Hin1II CATG 3 cut(s) 271, 292, 371
Hpy166II GTNNAC 1 cut(s) 75
Hpy188I TCNGA 3 cut(s) 157, 297, 421
Hpy188III TCNNGA 3 cut(s) 260, 376, 387
Hpy8I GTNNAC 1 cut(s) 75
Hpy99I CGWCG 1 cut(s) 266
HpyAV CCTTC 3 cut(s) 114, 372, 373
HpyCH4III ACNGT 1 cut(s) 185
HpyCH4V TGCA 1 cut(s) 404
HpyF10VI GCNNNNNNNGC 4 cut(s) 23, 29, 43, 401
HpyF3I CTNAG 2 cut(s) 27, 156
Hsp92II CATG 3 cut(s) 271, 292, 371
LpnPI CCDG 4 cut(s) 123, 336, 353, 389
Lsp1109I GCAGC 2 cut(s) 7, 29
MaeI CTAG 1 cut(s) 347
MaeIII GTNAC 1 cut(s) 179
MboII GAAGA 1 cut(s) 205
MluCI AATT 2 cut(s) 131, 141
MseI TTAA 2 cut(s) 129, 144
MspA1I CMGCKG 1 cut(s) 20
MwoI GCNNNNNNNGC 4 cut(s) 23, 29, 43, 401
NlaIII CATG 3 cut(s) 271, 292, 371
NlaIV GGNNCC 2 cut(s) 117, 259
NmeAIII GCCGAG 1 cut(s) 214
NmuCI GTSAC 1 cut(s) 179
NspI RCATGY 1 cut(s) 292
PkrI GCNGC 3 cut(s) 19, 22, 25
PspFI CCCAGC 1 cut(s) 350
PspN4I GGNNCC 2 cut(s) 117, 259
PspPI GGNCC 2 cut(s) 116, 257
PsrI GAACNNNNNNTAC 2 cut(s) 56, 88
PvuII CAGCTG 1 cut(s) 20
RsaI GTAC 1 cut(s) 74
RsaNI GTAC 1 cut(s) 73
SaqAI TTAA 2 cut(s) 129, 144
SatI GCNGC 3 cut(s) 18, 21, 24
Sau96I GGNCC 2 cut(s) 116, 257
SfcI CTRYAG 1 cut(s) 324
SinI GGWCC 2 cut(s) 116, 257
Sse9I AATT 2 cut(s) 131, 141
SsiI CCGC 1 cut(s) 24
SspMI CTAG 1 cut(s) 347
TaaI ACNGT 1 cut(s) 185
TaqII GACCGA 1 cut(s) 318
TasI AATT 2 cut(s) 131, 141
TauI GCSGC 1 cut(s) 26
Tru1I TTAA 2 cut(s) 129, 144
Tru9I TTAA 2 cut(s) 129, 144
TscAI CASTG 1 cut(s) 190
TseFI GTSAC 1 cut(s) 179
TseI GCWGC 2 cut(s) 17, 20
Tsp45I GTSAC 1 cut(s) 179
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 108
TspRI CASTG 1 cut(s) 190
VpaK11BI GGWCC 2 cut(s) 116, 257
XceI RCATGY 1 cut(s) 292
XcmI CCANNNNNNNNNTGG 1 cut(s) 347
XspI CTAG 1 cut(s) 347
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.