Rh2BG339100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
45082428 .. 45121456
39029 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG339100.1

Sequence Viewer

Length: 298 bp
ATGCTGTCTGATGTCCAAATTGCTGAAAGATCAAATCAATCTGGGAATATTGATGGATTTGAGTACGATGATGAACGGTTTAGGAATCAGAACCAAAATAATTTCTGTATGGATGACAACAGACGCTCTCCTTCAACTGTGGTTGCACAAGGGAATCAATGTAGTGCAATTAACTCGAGGAGGTGGAAAACATTATCTCAACCAATAAGGACAAGAGAGAATCAGCTTGGGGAAATGAGCAATCAAAATGTTGACATAATGGAAGATCGTGATCAACAAGAGGTTGTTCAGGTCACAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.5

Weight (kDa)

4.59

Isoelectric Point (pI)

61.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 1 cut(s) 135
AluBI AGCT 1 cut(s) 226
AluI AGCT 1 cut(s) 226
Ama87I CYCGRG 1 cut(s) 175
AvaI CYCGRG 1 cut(s) 175
BccI CCATC 1 cut(s) 47
BcgI CGANNNNNNTGC 2 cut(s) 156, 190
BclI TGATCA 1 cut(s) 271
BmeT110I CYCGRG 1 cut(s) 175
BsaBI GATNNNNATC 1 cut(s) 270
Bse8I GATNNNNATC 1 cut(s) 270
BseGI GGATG 1 cut(s) 118
BseJI GATNNNNATC 1 cut(s) 270
BseRI GAGGAG 1 cut(s) 193
BsiHKCI CYCGRG 1 cut(s) 175
BsoBI CYCGRG 1 cut(s) 175
Bsp143I GATC 3 cut(s) 29, 265, 271
BssMI GATC 3 cut(s) 29, 265, 271
Bst4CI ACNGT 2 cut(s) 78, 139
BstF5I GGATG 1 cut(s) 118
BstKTI GATC 3 cut(s) 32, 268, 274
BstMBI GATC 3 cut(s) 29, 265, 271
BtsCI GGATG 1 cut(s) 118
CseI GACGC 1 cut(s) 132
Csp6I GTAC 1 cut(s) 64
CviJI RGCY 1 cut(s) 226
CviKI_1 RGCY 1 cut(s) 226
CviQI GTAC 1 cut(s) 64
DpnI GATC 3 cut(s) 31, 267, 273
DpnII GATC 3 cut(s) 29, 265, 271
Eco88I CYCGRG 1 cut(s) 175
FaiI YATR 2 cut(s) 110, 257
FbaI TGATCA 1 cut(s) 271
FokI GGATG 1 cut(s) 125
HgaI GACGC 1 cut(s) 132
HincII GTYRAC 1 cut(s) 253
HindII GTYRAC 1 cut(s) 253
HinfI GANTC 3 cut(s) 85, 154, 220
Hpy166II GTNNAC 1 cut(s) 253
Hpy188I TCNGA 2 cut(s) 10, 90
Hpy188III TCNNGA 1 cut(s) 269
Hpy8I GTNNAC 1 cut(s) 253
HpyAV CCTTC 1 cut(s) 141
HpyCH4III ACNGT 2 cut(s) 78, 139
HpyCH4V TGCA 2 cut(s) 146, 167
Ksp22I TGATCA 1 cut(s) 271
Kzo9I GATC 3 cut(s) 29, 265, 271
LpnPI CCDG 2 cut(s) 27, 275
MaeIII GTNAC 1 cut(s) 292
MalI GATC 3 cut(s) 31, 267, 273
MboI GATC 3 cut(s) 29, 265, 271
MboII GAAGA 1 cut(s) 275
MluCI AATT 3 cut(s) 18, 100, 168
MnlI CCTC 3 cut(s) 171, 174, 274
MseI TTAA 1 cut(s) 171
NdeII GATC 3 cut(s) 29, 265, 271
NmuCI GTSAC 1 cut(s) 292
PaeR7I CTCGAG 1 cut(s) 175
PfeI GAWTC 3 cut(s) 85, 154, 220
PspXI VCTCGAGB 1 cut(s) 175
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SaqAI TTAA 1 cut(s) 171
Sau3AI GATC 3 cut(s) 29, 265, 271
SetI ASST 4 cut(s) 185, 228, 285, 294
Sfr274I CTCGAG 1 cut(s) 175
SgeI CNNG 8 cut(s) 54, 161, 187, 189, 225, 239, 281, 290
SlaI CTCGAG 1 cut(s) 175
SmlI CTYRAG 1 cut(s) 175
SmoI CTYRAG 1 cut(s) 175
Sse9I AATT 3 cut(s) 18, 100, 168
SspI AATATT 1 cut(s) 49
TaaI ACNGT 2 cut(s) 78, 139
TaqI TCGA 1 cut(s) 176
TasI AATT 3 cut(s) 18, 100, 168
TfiI GAWTC 3 cut(s) 85, 154, 220
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TseFI GTSAC 1 cut(s) 292
Tsp45I GTSAC 1 cut(s) 292
TspDTI ATGAA 1 cut(s) 87
XhoI CTCGAG 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.