Rh6DG023800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0002282
Physical Location & Seq
Reverse (-)
2099204 .. 2116048
16845 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG023800.1

Sequence Viewer

Length: 246 bp
ATGATTCAATTCACTCAGAGATTACAGGTCCAAAAAAGATACATTGTCTTGGCAACAGTATATTTCTTCTGCTTTTCGATGACAATGTTTGATGTCCAAATTGCTGAAGGATCAAATCAATCTGAGAATATTGATGGATTTGAGTACTATGATGAACGGTTTAGGAATCAGAATCAAAATAATTTCTGTAGCGATGACAACGGACGCTCTCCTACAGCTGTGGTTGCACAAGGGGCCGAACTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.44

Weight (kDa)

4.46

Isoelectric Point (pI)

35.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 118
AcuI CTGAAG 1 cut(s) 126
AfaI GTAC 1 cut(s) 146
AgsI TTSAA 1 cut(s) 8
AluBI AGCT 1 cut(s) 218
AluI AGCT 1 cut(s) 218
AlwI GGATC 1 cut(s) 118
AoxI GGCC 1 cut(s) 234
AspS9I GGNCC 2 cut(s) 28, 234
AvaII GGWCC 1 cut(s) 28
BccI CCATC 1 cut(s) 128
BfmI CTRYAG 2 cut(s) 187, 213
BmcAI AGTACT 1 cut(s) 146
Bme18I GGWCC 1 cut(s) 28
BmgT120I GGNCC 2 cut(s) 28, 234
BmiI GGNNCC 1 cut(s) 235
BseMII CTCAG 2 cut(s) 29, 114
BshFI GGCC 1 cut(s) 236
BsnI GGCC 1 cut(s) 236
Bsp143I GATC 1 cut(s) 110
BspANI GGCC 1 cut(s) 236
BspCNI CTCAG 2 cut(s) 28, 115
BspLI GGNNCC 1 cut(s) 235
BspPI GGATC 1 cut(s) 118
BssMI GATC 1 cut(s) 110
Bst4CI ACNGT 2 cut(s) 58, 159
BstDEI CTNAG 2 cut(s) 15, 123
BstKTI GATC 1 cut(s) 113
BstMBI GATC 1 cut(s) 110
BstMWI GCNNNNNNNGC 2 cut(s) 224, 233
BstSFI CTRYAG 2 cut(s) 187, 213
BsuRI GGCC 1 cut(s) 236
BtgZI GCGATG 1 cut(s) 207
Cfr13I GGNCC 2 cut(s) 28, 234
CseI GACGC 1 cut(s) 213
Csp6I GTAC 1 cut(s) 145
CviJI RGCY 2 cut(s) 218, 236
CviKI_1 RGCY 2 cut(s) 218, 236
CviQI GTAC 1 cut(s) 145
DdeI CTNAG 2 cut(s) 15, 123
DpnI GATC 1 cut(s) 112
DpnII GATC 1 cut(s) 110
Eco47I GGWCC 1 cut(s) 28
Eco57I CTGAAG 1 cut(s) 126
FaiI YATR 3 cut(s) 61, 150, 244
HaeIII GGCC 1 cut(s) 236
HgaI GACGC 1 cut(s) 213
HinfI GANTC 3 cut(s) 4, 166, 172
Hpy188I TCNGA 3 cut(s) 18, 124, 171
HpyAV CCTTC 1 cut(s) 101
HpyCH4III ACNGT 2 cut(s) 58, 159
HpyCH4V TGCA 1 cut(s) 227
HpyF10VI GCNNNNNNNGC 2 cut(s) 224, 233
HpyF3I CTNAG 2 cut(s) 15, 123
Kzo9I GATC 1 cut(s) 110
LpnPI CCDG 1 cut(s) 11
MalI GATC 1 cut(s) 112
MboI GATC 1 cut(s) 110
MboII GAAGA 1 cut(s) 58
MluCI AATT 3 cut(s) 8, 99, 181
MspA1I CMGCKG 1 cut(s) 218
MwoI GCNNNNNNNGC 2 cut(s) 224, 233
NdeII GATC 1 cut(s) 110
NlaIV GGNNCC 1 cut(s) 235
PfeI GAWTC 3 cut(s) 4, 166, 172
PspN4I GGNNCC 1 cut(s) 235
PspPI GGNCC 2 cut(s) 28, 234
PvuII CAGCTG 1 cut(s) 218
RsaI GTAC 1 cut(s) 146
RsaNI GTAC 1 cut(s) 145
Sau3AI GATC 1 cut(s) 110
Sau96I GGNCC 2 cut(s) 28, 234
ScaI AGTACT 1 cut(s) 146
SetI ASST 2 cut(s) 30, 220
SfcI CTRYAG 2 cut(s) 187, 213
SgeI CNNG 3 cut(s) 38, 61, 242
SinI GGWCC 1 cut(s) 28
Sse9I AATT 3 cut(s) 8, 99, 181
SspI AATATT 1 cut(s) 130
TaaI ACNGT 2 cut(s) 58, 159
TaqI TCGA 1 cut(s) 77
TasI AATT 3 cut(s) 8, 99, 181
TatI WGTACW 1 cut(s) 144
TfiI GAWTC 3 cut(s) 4, 166, 172
TspDTI ATGAA 1 cut(s) 168
TspGWI ACGGA 1 cut(s) 216
VpaK11BI GGWCC 1 cut(s) 28
ZrmI AGTACT 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.