RchiOBHm_Chr2g0168141

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0002282
Physical Location & Seq
Reverse (-)
82601923 .. 82616152
14230 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53584

Sequence Viewer

Length: 765 bp
ATGCAAAGGAGTATCTACATTGTTCTGTTGCCACTGTTCCTAATTCTGTTGTTTGGTGTTAGTTCAGTGCCCAGTTTTCATTCAGATATCAGGAATAGTGTGTTATCTAAAACTACAAGTATTTCAAATTCAGTAATGGGACCAAAACCAATGTTTAGAAGAACAAAGAGGGATACAAGTGAACACGCAATTCGGCAAAGAAGAACTAAATCTAATTGTGTTTTGTTCGGTGGACATCAATACGATGAGGCTAGATCAAAGAAATCGAAAACAATGTCTGATGTCCAAATTGCTGAAAGATCAAATCAATCTGGGAATATTGATGGATTTGAGTACTATGATGAATGGTTTAGGAATCAGAACCAAAATAATTTCTGTATGGATGACAACGGACGCTCTCCTTCAACTGTGGTTGCACAAGGGAATCAATATAGTGCAATTAACTCGAGGAGGTGGAAAACATTATCTCAACCAATAATGACAAGAGAGAATCAGCTTGGGGAAATGAGCAATCCGAATGTTGACATAATGGAAAATCGTGATCAACAAGAGGTTGTTCAGGTCACAGATGAATATCAATATTCATACGGTCAAGCATCATATCAAAGAAGTAAACAAGGATCCGCTATTGCATATGAAGATTCAGGAATCAGCAACAGTGAAACCTCGGTGAGAGCTCAATTTTTTAAATCAATATCAACACAAGAGTTACAGCATTTGCTAAAGAAAAGTTCTCCAGATTTTGATCGTAAATCACTGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

254

Amino Acids

29.13

Weight (kDa)

8.98

Isoelectric Point (pI)

48.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 624
AclWI GGATC 2 cut(s) 615, 628
AcsI RAATTY 1 cut(s) 127
AfaI GTAC 1 cut(s) 335
AgsI TTSAA 2 cut(s) 126, 405
AluBI AGCT 2 cut(s) 496, 677
AluI AGCT 2 cut(s) 496, 677
Alw21I GWGCWC 1 cut(s) 679
AlwI GGATC 2 cut(s) 615, 628
Ama87I CYCGRG 1 cut(s) 445
ApoI RAATTY 1 cut(s) 127
ArsI GACNNNNNNTTYG 2 cut(s) 260, 292
AspS9I GGNCC 1 cut(s) 140
AsuHPI GGTGA 1 cut(s) 682
AvaI CYCGRG 1 cut(s) 445
AvaII GGWCC 1 cut(s) 140
BaeGI GKGCMC 1 cut(s) 72
BamHI GGATCC 1 cut(s) 620
BanII GRGCYC 1 cut(s) 679
Bbv12I GWGCWC 1 cut(s) 679
BccI CCATC 1 cut(s) 317
BcgI CGANNNNNNTGC 2 cut(s) 426, 460
BciVI GTATCC 1 cut(s) 166
BclI TGATCA 1 cut(s) 541
BfaI CTAG 1 cut(s) 252
BfuI GTATCC 1 cut(s) 166
BmcAI AGTACT 1 cut(s) 335
Bme18I GGWCC 1 cut(s) 140
BmeT110I CYCGRG 1 cut(s) 445
BmgT120I GGNCC 1 cut(s) 140
BmiI GGNNCC 2 cut(s) 141, 622
BmrI ACTGGG 1 cut(s) 66
BmsI GCATC 1 cut(s) 605
BmuI ACTGGG 1 cut(s) 66
BpmI CTGGAG 1 cut(s) 720
BsaBI GATNNNNATC 2 cut(s) 573, 744
BsaJI CCNNGG 1 cut(s) 666
Bse1I ACTGG 2 cut(s) 72, 762
Bse8I GATNNNNATC 2 cut(s) 573, 744
BseDI CCNNGG 1 cut(s) 666
BseGI GGATG 1 cut(s) 388
BseJI GATNNNNATC 2 cut(s) 573, 744
BseNI ACTGG 2 cut(s) 72, 762
BseRI GAGGAG 1 cut(s) 463
BseSI GKGCMC 1 cut(s) 72
BsiHKAI GWGCWC 1 cut(s) 679
BsiHKCI CYCGRG 1 cut(s) 445
BslFI GGGAC 1 cut(s) 153
BsmFI GGGAC 1 cut(s) 153
BsoBI CYCGRG 1 cut(s) 445
Bsp1286I GDGCHC 2 cut(s) 72, 679
Bsp143I GATC 5 cut(s) 254, 299, 541, 620, 745
BspACI CCGC 1 cut(s) 624
BspLI GGNNCC 2 cut(s) 141, 622
BspPI GGATC 2 cut(s) 615, 628
BsrI ACTGG 2 cut(s) 72, 762
BssECI CCNNGG 1 cut(s) 666
BssMI GATC 5 cut(s) 254, 299, 541, 620, 745
Bst4CI ACNGT 4 cut(s) 36, 409, 590, 659
BstF5I GGATG 1 cut(s) 388
BstKTI GATC 5 cut(s) 257, 302, 544, 623, 748
BstMBI GATC 5 cut(s) 254, 299, 541, 620, 745
BstSLI GKGCMC 1 cut(s) 72
BstX2I RGATCY 1 cut(s) 620
BstYI RGATCY 1 cut(s) 620
BsuI GTATCC 1 cut(s) 166
BtsCI GGATG 1 cut(s) 388
BtsIMutI CAGTG 4 cut(s) 32, 72, 664, 755
Cfr13I GGNCC 1 cut(s) 140
CseI GACGC 1 cut(s) 402
Csp6I GTAC 1 cut(s) 334
CviJI RGCY 3 cut(s) 251, 496, 677
CviKI_1 RGCY 3 cut(s) 251, 496, 677
CviQI GTAC 1 cut(s) 334
DpnI GATC 5 cut(s) 256, 301, 543, 622, 747
DpnII GATC 5 cut(s) 254, 299, 541, 620, 745
DraI TTTAAA 1 cut(s) 688
Ecl136II GAGCTC 1 cut(s) 677
Eco24I GRGCYC 1 cut(s) 679
Eco32I GATATC 1 cut(s) 88
Eco47I GGWCC 1 cut(s) 140
Eco53kI GAGCTC 1 cut(s) 677
Eco88I CYCGRG 1 cut(s) 445
EcoICRI GAGCTC 1 cut(s) 677
EcoRV GATATC 1 cut(s) 88
EcoT38I GRGCYC 1 cut(s) 679
FaiI YATR 8 cut(s) 339, 380, 432, 527, 586, 601, 634, 636
FaqI GGGAC 1 cut(s) 153
FauNDI CATATG 1 cut(s) 634
FbaI TGATCA 1 cut(s) 541
FokI GGATG 1 cut(s) 395
FriOI GRGCYC 1 cut(s) 679
FspBI CTAG 1 cut(s) 252
GsuI CTGGAG 1 cut(s) 720
HgaI GACGC 1 cut(s) 402
HincII GTYRAC 1 cut(s) 523
HindII GTYRAC 1 cut(s) 523
HinfI GANTC 5 cut(s) 355, 424, 490, 641, 648
HphI GGTGA 1 cut(s) 682
Hpy166II GTNNAC 4 cut(s) 182, 233, 523, 614
Hpy188I TCNGA 4 cut(s) 85, 280, 360, 516
Hpy188III TCNNGA 4 cut(s) 91, 539, 645, 737
Hpy8I GTNNAC 4 cut(s) 182, 233, 523, 614
HpyAV CCTTC 1 cut(s) 411
HpyCH4III ACNGT 4 cut(s) 36, 409, 590, 659
HpyCH4V TGCA 4 cut(s) 4, 416, 437, 632
Ksp22I TGATCA 1 cut(s) 541
Kzo9I GATC 5 cut(s) 254, 299, 541, 620, 745
LpnPI CCDG 7 cut(s) 76, 85, 297, 545, 630, 743, 750
LweI GCATC 1 cut(s) 605
MaeI CTAG 1 cut(s) 252
MaeIII GTNAC 2 cut(s) 562, 708
MalI GATC 5 cut(s) 256, 301, 543, 622, 747
MboI GATC 5 cut(s) 254, 299, 541, 620, 745
MboII GAAGA 3 cut(s) 171, 213, 650
MflI RGATCY 1 cut(s) 620
MhlI GDGCHC 2 cut(s) 72, 679
MluCI AATT 8 cut(s) 42, 127, 189, 214, 288, 370, 438, 680
MnlI CCTC 6 cut(s) 162, 241, 441, 444, 544, 676
MseI TTAA 2 cut(s) 441, 687
NdeI CATATG 1 cut(s) 634
NdeII GATC 5 cut(s) 254, 299, 541, 620, 745
NlaIV GGNNCC 2 cut(s) 141, 622
NmuCI GTSAC 1 cut(s) 562
PaeR7I CTCGAG 1 cut(s) 445
PfeI GAWTC 5 cut(s) 355, 424, 490, 641, 648
Psp124BI GAGCTC 1 cut(s) 679
PspN4I GGNNCC 2 cut(s) 141, 622
PspPI GGNCC 1 cut(s) 140
PspXI VCTCGAGB 1 cut(s) 445
PsuI RGATCY 1 cut(s) 620
RsaI GTAC 1 cut(s) 335
RsaNI GTAC 1 cut(s) 334
SacI GAGCTC 1 cut(s) 679
SaqAI TTAA 2 cut(s) 441, 687
Sau3AI GATC 5 cut(s) 254, 299, 541, 620, 745
Sau96I GGNCC 1 cut(s) 140
ScaI AGTACT 1 cut(s) 335
SduI GDGCHC 2 cut(s) 72, 679
SetI ASST 6 cut(s) 455, 498, 555, 564, 668, 679
SfaNI GCATC 1 cut(s) 605
Sfr274I CTCGAG 1 cut(s) 445
SinI GGWCC 1 cut(s) 140
SlaI CTCGAG 1 cut(s) 445
SmlI CTYRAG 1 cut(s) 445
SmoI CTYRAG 1 cut(s) 445
Sse9I AATT 8 cut(s) 42, 127, 189, 214, 288, 370, 438, 680
SsiI CCGC 1 cut(s) 624
SspI AATATT 2 cut(s) 319, 581
SspMI CTAG 1 cut(s) 252
SstI GAGCTC 1 cut(s) 679
TaaI ACNGT 4 cut(s) 36, 409, 590, 659
TaqI TCGA 2 cut(s) 266, 446
TasI AATT 8 cut(s) 42, 127, 189, 214, 288, 370, 438, 680
TatI WGTACW 1 cut(s) 333
TfiI GAWTC 5 cut(s) 355, 424, 490, 641, 648
Tru1I TTAA 2 cut(s) 441, 687
Tru9I TTAA 2 cut(s) 441, 687
TscAI CASTG 4 cut(s) 39, 72, 664, 762
TseFI GTSAC 1 cut(s) 562
Tsp45I GTSAC 1 cut(s) 562
TspDTI ATGAA 5 cut(s) 68, 357, 573, 585, 651
TspGWI ACGGA 1 cut(s) 405
TspRI CASTG 4 cut(s) 39, 72, 664, 762
VpaK11BI GGWCC 1 cut(s) 140
XapI RAATTY 1 cut(s) 127
XhoI CTCGAG 1 cut(s) 445
XspI CTAG 1 cut(s) 252
ZrmI AGTACT 1 cut(s) 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.