Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0002282

Physical Location & Seq

Genomic Coordinates Reverse (-)

35494598 .. 35497702

Gene Structure 3105 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00193890.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 153 bp

ATGGGACCAAAACCAATGTTTAGAAAAACAAAGAGGGATACAAGTGAACACGCAATTCGGCAAAGAAGAACTAAATCTAATTGTATTTTGTCCGATGGACATCAATACGATGAGGCTAGATCAAAGAAATCGAAAACAAGGGCCGAACTATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

50

Amino Acids

5.88

Weight (kDa)

10.43

Isoelectric Point (pI)

43.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002282)

Species	Orthologous Gene IDs
pyrus_communis	pycom10g17910
rosa_chinensis	RchiOBHm_Chr2g0127881 RchiOBHm_Chr2g0128071 RchiOBHm_Chr2g0168141 RchiOBHm_Chr4g0394061 RchiOBHm_Chr4g0409481 RchiOBHm_Chr5g0057941 RchiOBHm_Chr6g0289331
rosa_multiflora	Rmu_sc0001136.1_g000034 Rmu_sc0002501.1_g000016 Rmu_sc0003941.1_g000003 Rmu_sc0012303.1_g000002 Rmu_sc0018337.1_g000005 Rmu_sc0023137.1_g000011 Rmu_sc0037818.1_g000001 Rmu_ssc0000118.1_g000006
rosa_roxburghii	Rroxscaffold_177G00434380 Rroxscaffold_1G00074020 Rroxscaffold_2G00119630 Rroxscaffold_4G00297870 Rroxscaffold_4G00303680 Rroxscaffold_4G00311340 Rroxscaffold_5G00333250 Rroxscaffold_5G00333260 Rroxscaffold_5G00365770 Rroxscaffold_5G00382860 Rroxscaffold_6G00423070 Rroxscaffold_7G00193890 Rroxscaffold_7G00201810
rosa_rugosa	Rorug05G0198200 Rorug05G0255000 Rorug05G0428300
rosa_samantha	Rh2BG339100 Rh2BG613700 Rh2CG365300 Rh5BG509200 Rh5DG521900 Rh6AG198000 Rh6BG265900 Rh6CG023900 Rh6DG023800 Rh7DG045500
rosa_wichuraiana	Rw0G014170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AoxI	GGCC	1 cut(s)	141
AspS9I	GGNCC	2 cut(s)	5, 141
AvaII	GGWCC	1 cut(s)	5
BccI	CCATC	1 cut(s)	89
BciVI	GTATCC	1 cut(s)	31
BfaI	CTAG	1 cut(s)	117
BfuI	GTATCC	1 cut(s)	31
Bme18I	GGWCC	1 cut(s)	5
BmgT120I	GGNCC	2 cut(s)	5, 141
BmiI	GGNNCC	1 cut(s)	6
BsaBI	GATNNNNATC	1 cut(s)	99
Bse8I	GATNNNNATC	1 cut(s)	99
BseJI	GATNNNNATC	1 cut(s)	99
BshFI	GGCC	1 cut(s)	143
BslFI	GGGAC	1 cut(s)	18
BsmFI	GGGAC	1 cut(s)	18
BsnI	GGCC	1 cut(s)	143
Bsp143I	GATC	1 cut(s)	119
BspANI	GGCC	1 cut(s)	143
BspLI	GGNNCC	1 cut(s)	6
BssMI	GATC	1 cut(s)	119
BstKTI	GATC	1 cut(s)	122
BstMBI	GATC	1 cut(s)	119
BsuI	GTATCC	1 cut(s)	31
BsuRI	GGCC	1 cut(s)	143
Cfr13I	GGNCC	2 cut(s)	5, 141
CviJI	RGCY	2 cut(s)	116, 143
CviKI_1	RGCY	2 cut(s)	116, 143
DpnI	GATC	1 cut(s)	121
DpnII	GATC	1 cut(s)	119
Eco47I	GGWCC	1 cut(s)	5
FaiI	YATR	1 cut(s)	151
FaqI	GGGAC	1 cut(s)	18
FspBI	CTAG	1 cut(s)	117
HaeIII	GGCC	1 cut(s)	143
Hpy166II	GTNNAC	1 cut(s)	47
Hpy188I	TCNGA	1 cut(s)	94
Hpy8I	GTNNAC	1 cut(s)	47
Kzo9I	GATC	1 cut(s)	119
MaeI	CTAG	1 cut(s)	117
MalI	GATC	1 cut(s)	121
MboI	GATC	1 cut(s)	119
MboII	GAAGA	1 cut(s)	78
MluCI	AATT	2 cut(s)	54, 79
MnlI	CCTC	2 cut(s)	27, 106
NdeII	GATC	1 cut(s)	119
NlaIV	GGNNCC	1 cut(s)	6
PspN4I	GGNNCC	1 cut(s)	6
PspPI	GGNCC	2 cut(s)	5, 141
Sau3AI	GATC	1 cut(s)	119
Sau96I	GGNCC	2 cut(s)	5, 141
SgeI	CNNG	3 cut(s)	54, 62, 129
SinI	GGWCC	1 cut(s)	5
Sse9I	AATT	2 cut(s)	54, 79
SspMI	CTAG	1 cut(s)	117
TaqI	TCGA	1 cut(s)	131
TasI	AATT	2 cut(s)	54, 79
VpaK11BI	GGWCC	1 cut(s)	5
XspI	CTAG	1 cut(s)	117

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.