Rh5BG509200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
80990020 .. 80996257
6238 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG509200.1

Sequence Viewer

Length: 225 bp
ATGCTGAGTTCACCACCATCTCCGCCAGACAAGGAATGGACGACGATTGATGAGGTTGGGGATAGAGATCTCGGAGTCTCTGCACCAGAACCAGAAGGGCATGATGATCAAGAAGCAGTGCGCCTCGATCCCCGTTGTGATGAGCCGACATCTCTGAACATCGTACTCTGTCACACTCCTAGCTTCCGAGCAAAAATGGGTGGAAAGATTGAAGCTTTAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.04

Weight (kDa)

4.43

Isoelectric Point (pI)

60.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 23
AclWI GGATC 1 cut(s) 122
AfaI GTAC 1 cut(s) 165
AgsI TTSAA 1 cut(s) 212
AluBI AGCT 2 cut(s) 183, 215
AluI AGCT 2 cut(s) 183, 215
Alw26I GTCTC 1 cut(s) 82
AlwI GGATC 1 cut(s) 122
AspLEI GCGC 1 cut(s) 123
AsuHPI GGTGA 1 cut(s) 3
BccI CCATC 1 cut(s) 25
BclI TGATCA 1 cut(s) 106
BcoDI GTCTC 1 cut(s) 82
BfaI CTAG 1 cut(s) 180
BglII AGATCT 1 cut(s) 67
BsaBI GATNNNNATC 1 cut(s) 66
Bse8I GATNNNNATC 1 cut(s) 66
BseJI GATNNNNATC 1 cut(s) 66
BsgI GTGCAG 1 cut(s) 66
BsmAI GTCTC 1 cut(s) 82
Bsp143I GATC 3 cut(s) 67, 106, 127
BspACI CCGC 1 cut(s) 23
BspPI GGATC 1 cut(s) 122
BssMI GATC 3 cut(s) 67, 106, 127
BstDEI CTNAG 1 cut(s) 5
BstHHI GCGC 1 cut(s) 123
BstKTI GATC 3 cut(s) 70, 109, 130
BstMAI GTCTC 1 cut(s) 82
BstMBI GATC 3 cut(s) 67, 106, 127
BstX2I RGATCY 1 cut(s) 67
BstYI RGATCY 1 cut(s) 67
BtsI GCAGTG 1 cut(s) 123
BtsIMutI CAGTG 1 cut(s) 123
CfoI GCGC 1 cut(s) 123
Csp6I GTAC 1 cut(s) 164
CviAII CATG 1 cut(s) 101
CviJI RGCY 3 cut(s) 145, 183, 215
CviKI_1 RGCY 3 cut(s) 145, 183, 215
CviQI GTAC 1 cut(s) 164
DdeI CTNAG 1 cut(s) 5
DpnI GATC 3 cut(s) 69, 108, 129
DpnII GATC 3 cut(s) 67, 106, 127
EciI GGCGGA 1 cut(s) 12
FaeI CATG 1 cut(s) 104
FaiI YATR 1 cut(s) 102
FatI CATG 1 cut(s) 100
FbaI TGATCA 1 cut(s) 106
FspBI CTAG 1 cut(s) 180
GlaI GCGC 1 cut(s) 122
HhaI GCGC 1 cut(s) 123
Hin1II CATG 1 cut(s) 104
Hin6I GCGC 1 cut(s) 121
HinP1I GCGC 1 cut(s) 121
HindIII AAGCTT 1 cut(s) 213
HinfI GANTC 1 cut(s) 75
HphI GGTGA 1 cut(s) 3
Hpy166II GTNNAC 1 cut(s) 11
Hpy188I TCNGA 3 cut(s) 74, 156, 188
Hpy188III TCNNGA 1 cut(s) 110
Hpy8I GTNNAC 1 cut(s) 11
Hpy99I CGWCG 1 cut(s) 46
HpyAV CCTTC 1 cut(s) 89
HpyCH4V TGCA 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 5
Hsp92II CATG 1 cut(s) 104
HspAI GCGC 1 cut(s) 121
Ksp22I TGATCA 1 cut(s) 106
Kzo9I GATC 3 cut(s) 67, 106, 127
LpnPI CCDG 3 cut(s) 39, 99, 105
MaeI CTAG 1 cut(s) 180
MaeIII GTNAC 1 cut(s) 170
MalI GATC 3 cut(s) 69, 108, 129
MboI GATC 3 cut(s) 67, 106, 127
MflI RGATCY 1 cut(s) 67
MlyI GAGTC 1 cut(s) 84
MnlI CCTC 2 cut(s) 46, 134
MseI TTAA 1 cut(s) 218
NdeII GATC 3 cut(s) 67, 106, 127
NlaIII CATG 1 cut(s) 104
NmuCI GTSAC 1 cut(s) 170
PleI GAGTC 1 cut(s) 83
PpsI GAGTC 1 cut(s) 83
PsuI RGATCY 1 cut(s) 67
RsaI GTAC 1 cut(s) 165
RsaNI GTAC 1 cut(s) 164
SaqAI TTAA 1 cut(s) 218
Sau3AI GATC 3 cut(s) 67, 106, 127
SchI GAGTC 1 cut(s) 84
SetI ASST 3 cut(s) 57, 185, 217
SsiI CCGC 1 cut(s) 23
SspMI CTAG 1 cut(s) 180
TaqI TCGA 1 cut(s) 126
Tru1I TTAA 1 cut(s) 218
Tru9I TTAA 1 cut(s) 218
TscAI CASTG 1 cut(s) 123
TseFI GTSAC 1 cut(s) 170
Tsp45I GTSAC 1 cut(s) 170
TspRI CASTG 1 cut(s) 123
XcmI CCANNNNNNNNNTGG 1 cut(s) 33
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.