Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0001850

Physical Location & Seq

Genomic Coordinates Forward (+)

61713279 .. 61716486

Gene Structure 3208 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ33446

Sequence Viewer

CDS Protein Promoter (2k)

Length: 258 bp

ATGATTGACGAGGATTTACCCATTTTAAGAAAAGCAATAGGGACTGATATAGAATGGTATAGTAGAACACGTTTGACACCAAAGCTCAATGAGAAGAGGCTTTACAAGGGCACTAACAATTGGGGAAGTTTCTTCAACTTCTTCAGTCCACCCGAAGTCCCCAGAGTTATAGATGGAAAAGCGGTTTCTGAACTTATTAGGAGGATGATTCCAAGTCATACTAGTATGATTGTTCCAGATGATACATGTGTTCTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000150 GO:0000217 GO:0000400 GO:0000724 GO:0000725 GO:0000730 GO:0003674 GO:0003676 GO:0003677 GO:0003690 GO:0003697 GO:0003824 GO:0005488 GO:0006139 GO:0006259 GO:0006281 GO:0006302 GO:0006310 GO:0006312 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008094 GO:0008150 GO:0008152 GO:0009314 GO:0009628 GO:0009987 GO:0010212 GO:0016043 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022607 GO:0033554 GO:0034622 GO:0034641 GO:0042148 GO:0042623 GO:0043170 GO:0043933 GO:0044085 GO:0044237 GO:0044238 GO:0044260 GO:0045003 GO:0046483 GO:0050896 GO:0051716 GO:0065003 GO:0065004 GO:0071704 GO:0071824 GO:0071840 GO:0090304 GO:0090735 GO:0097159 GO:0140097 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NAP

Protein Analysis

85

Amino Acids

9.84

Weight (kDa)

7.89

Isoelectric Point (pI)

36.11

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
NAP	PF00956	6 - 56	5.5e-06	Nucleosome assembly protein (NAP)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001850)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0057701 RchiOBHm_Chr6g0278381
rosa_multiflora	Rmu_sc0002080.1_g000035 Rmu_sc0002482.1_g000015 Rmu_sc0003837.1_g000009 Rmu_sc0005852.1_g000009 Rmu_sc0006325.1_g000033 Rmu_sc0009634.1_g000001 Rmu_ssc0000435.1_g000003
rosa_roxburghii	Rroxscaffold_1G00033310 Rroxscaffold_2G00097210 Rroxscaffold_2G00100530 Rroxscaffold_3G00222980 Rroxscaffold_3G00223140 Rroxscaffold_4G00283070 Rroxscaffold_4G00302540 Rroxscaffold_5G00334950 Rroxscaffold_5G00336780 Rroxscaffold_5G00337950 Rroxscaffold_5G00358620 Rroxscaffold_5G00367500 Rroxscaffold_6G00401010 Rroxscaffold_6G00401040 Rroxscaffold_7G00179780 Rroxscaffold_7G00190410 Rroxscaffold_7G00190420 Rroxscaffold_7G00204930
rosa_rugosa	Rorug05G0490900.1 Rorug06G0116200
rosa_samantha	Rh1AG219300 Rh1BG343800 Rh1CG203800 Rh2BG515200 Rh2DG527300 Rh5CG412400 Rh6AG225900 Rh6AG229500 Rh6BG229900 Rh6BG240600 Rh6CG233100 Rh6DG224300 Rh7BG250000 Rh7CG511800 Rh7DG478500
rosa_wichuraiana	Rw6G007070 Rw6G019700 Rw6G020090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	182
AcuI	CTGAAG	1 cut(s)	127
AflIII	ACRYGT	2 cut(s)	68, 245
AgsI	TTSAA	1 cut(s)	136
AhlI	ACTAGT	1 cut(s)	221
AluBI	AGCT	1 cut(s)	85
AluI	AGCT	1 cut(s)	85
BaeGI	GKGCMC	1 cut(s)	113
BaeI	ACNNNNGTAYC	1 cut(s)	234
BarI	GAAGNNNNNNTAC	2 cut(s)	86, 118
BccI	CCATC	1 cut(s)	167
BcuI	ACTAGT	1 cut(s)	221
BfaI	CTAG	1 cut(s)	222
BseGI	GGATG	1 cut(s)	210
BseSI	GKGCMC	1 cut(s)	113
BslFI	GGGAC	2 cut(s)	55, 143
BsmFI	GGGAC	2 cut(s)	55, 143
Bsp1286I	GDGCHC	1 cut(s)	113
BspACI	CCGC	1 cut(s)	182
Bst6I	CTCTTC	1 cut(s)	89
BstF5I	GGATG	1 cut(s)	210
BstNSI	RCATGY	1 cut(s)	249
BstSLI	GKGCMC	1 cut(s)	113
BtsCI	GGATG	1 cut(s)	210
CviAII	CATG	1 cut(s)	246
CviJI	RGCY	2 cut(s)	85, 100
CviKI_1	RGCY	2 cut(s)	85, 100
Eam1104I	CTCTTC	1 cut(s)	89
EarI	CTCTTC	1 cut(s)	89
Eco57I	CTGAAG	1 cut(s)	127
FaeI	CATG	1 cut(s)	249
FaiI	YATR	6 cut(s)	50, 60, 170, 219, 227, 247
FaqI	GGGAC	2 cut(s)	55, 143
FatI	CATG	1 cut(s)	245
FokI	GGATG	1 cut(s)	217
FspBI	CTAG	1 cut(s)	222
Hin1II	CATG	1 cut(s)	249
HinfI	GANTC	1 cut(s)	208
Hpy166II	GTNNAC	1 cut(s)	149
Hpy188I	TCNGA	1 cut(s)	190
Hpy188III	TCNNGA	1 cut(s)	236
Hpy8I	GTNNAC	1 cut(s)	149
HpyCH4IV	ACGT	1 cut(s)	70
HpySE526I	ACGT	1 cut(s)	70
Hsp92II	CATG	1 cut(s)	249
LpnPI	CCDG	2 cut(s)	175, 249
MaeI	CTAG	1 cut(s)	222
MaeII	ACGT	1 cut(s)	70
MboII	GAAGA	3 cut(s)	106, 124, 133
MfeI	CAATTG	1 cut(s)	118
MhlI	GDGCHC	1 cut(s)	113
MluCI	AATT	1 cut(s)	118
MnlI	CCTC	3 cut(s)	4, 90, 195
MseI	TTAA	2 cut(s)	26, 256
MunI	CAATTG	1 cut(s)	118
NlaIII	CATG	1 cut(s)	249
NspI	RCATGY	1 cut(s)	249
PciI	ACATGT	1 cut(s)	245
PfeI	GAWTC	1 cut(s)	208
PscI	ACATGT	1 cut(s)	245
SaqAI	TTAA	2 cut(s)	26, 256
SduI	GDGCHC	1 cut(s)	113
SetI	ASST	2 cut(s)	73, 87
SgeI	CNNG	8 cut(s)	22, 81, 118, 164, 174, 225, 234, 248
SpeI	ACTAGT	1 cut(s)	221
Sse9I	AATT	1 cut(s)	118
SsiI	CCGC	1 cut(s)	182
SspMI	CTAG	1 cut(s)	222
TaiI	ACGT	1 cut(s)	73
TasI	AATT	1 cut(s)	118
TfiI	GAWTC	1 cut(s)	208
Tru1I	TTAA	2 cut(s)	26, 256
Tru9I	TTAA	2 cut(s)	26, 256
XceI	RCATGY	1 cut(s)	249
XspI	CTAG	1 cut(s)	222

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.