Rmu_sc0009634.1_g000001

Plant protein of unknown function (DUF863)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009634.1
OG0001850
Physical Location & Seq
Reverse (-)
3637 .. 6321
2685 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009634.1_g000001.1.cds

Sequence Viewer

Length: 624 bp
atgtgggtctcacaaaatgttcacgacgacgacagacagagggacgcaagcaaactgaagaaacctctccaaagctcagaagtctcccaagctcttgaagaaccatcaagctgccaaatagccgctctcttcacctcgctgacttcagacaagcacgggaaatcacctacaagctcggaagtcgtcaaacacgcggatgatcaacaagcaccaaatacacgtgccgattcatcctccatcaaagctaaagaacactcaccacgtgacatcgctcgtggttcaaatccgatcaagttcaagcttctacagctcttggtcaatcgtcttcctcaaatcgtcaacatagcaagaagctcacactacaaccgtttgattcaagatcaagtgctcgccacccttggatcaaatcaacacaacccaattgccgttgcaaaaacggccacaaaagggtcagacgaggagagggaggcaacagatcggaagaacttccagagggatgttctccctggtattgcttgtttgtcaagaaatgaggtgactgaggatctgctccatcgctatctactgcagttagtcagccccagatggattagcagccacaagaactggaggaaacaagtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF863

Protein Analysis

207

Amino Acids

23.29

Weight (kDa)

9.42

Isoelectric Point (pI)

53.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 125
AccII CGCG 1 cut(s) 194
AciI CCGC 2 cut(s) 123, 194
AclWI GGATC 2 cut(s) 409, 552
AcoI YGGCCR 1 cut(s) 438
AcuI CTGAAG 2 cut(s) 77, 129
AcvI CACGTG 2 cut(s) 221, 263
AdeI CACNNNGTG 1 cut(s) 263
AfiI CCNNNNNNNGG 1 cut(s) 447
AflIII ACRYGT 1 cut(s) 218
AgsI TTSAA 4 cut(s) 98, 282, 298, 377
AjnI CCWGG 1 cut(s) 505
AluBI AGCT 8 cut(s) 75, 92, 111, 174, 245, 301, 310, 354
AluI AGCT 8 cut(s) 75, 92, 111, 174, 245, 301, 310, 354
Alw21I GWGCWC 1 cut(s) 390
Alw26I GTCTC 2 cut(s) 13, 88
AlwI GGATC 2 cut(s) 409, 552
AoxI GGCC 1 cut(s) 438
ApeKI GCWGC 2 cut(s) 111, 594
Asp700I GAANNNNTTC 1 cut(s) 485
AsuHPI GGTGA 4 cut(s) 124, 156, 249, 547
BauI CACGAG 1 cut(s) 273
BbrPI CACGTG 2 cut(s) 221, 263
BbsI GAAGAC 1 cut(s) 317
Bbv12I GWGCWC 1 cut(s) 390
BbvI GCAGC 2 cut(s) 98, 606
BccI CCATC 4 cut(s) 112, 245, 561, 579
BceAI ACGGC 2 cut(s) 410, 453
BciT130I CCWGG 1 cut(s) 507
BclI TGATCA 1 cut(s) 199
BcoDI GTCTC 2 cut(s) 13, 88
BfaI CTAG 1 cut(s) 622
BfmI CTRYAG 2 cut(s) 305, 566
BisI GCNGC 3 cut(s) 112, 123, 595
BlsI GCNGC 3 cut(s) 113, 124, 596
Bme1390I CCNGG 1 cut(s) 507
BmrFI CCNGG 1 cut(s) 507
BpiI GAAGAC 1 cut(s) 317
BsaAI YACGTR 2 cut(s) 221, 263
BsaI GGTCTC 1 cut(s) 13
BsaJI CCNNGG 2 cut(s) 397, 505
Bsc4I CCNNNNNNNGG 1 cut(s) 447
Bse1I ACTGG 1 cut(s) 611
BseBI CCWGG 1 cut(s) 507
BseDI CCNNGG 2 cut(s) 397, 505
BseGI GGATG 3 cut(s) 202, 230, 502
BseLI CCNNNNNNNGG 1 cut(s) 447
BseMII CTCAG 2 cut(s) 90, 531
BseNI ACTGG 1 cut(s) 611
BseRI GAGGAG 1 cut(s) 473
BseXI GCAGC 2 cut(s) 98, 606
Bsh1236I CGCG 1 cut(s) 194
BshFI GGCC 1 cut(s) 440
BsiHKAI GWGCWC 1 cut(s) 390
BslFI GGGAC 1 cut(s) 56
BslI CCNNNNNNNGG 1 cut(s) 447
BsmAI GTCTC 2 cut(s) 13, 88
BsmFI GGGAC 1 cut(s) 56
BsnI GGCC 1 cut(s) 440
Bso31I GGTCTC 1 cut(s) 13
Bsp1286I GDGCHC 1 cut(s) 390
Bsp143I GATC 6 cut(s) 199, 288, 379, 401, 475, 544
BspACI CCGC 2 cut(s) 123, 194
BspANI GGCC 1 cut(s) 440
BspCNI CTCAG 2 cut(s) 89, 532
BspFNI CGCG 1 cut(s) 194
BspMAI CTGCAG 1 cut(s) 570
BspPI GGATC 2 cut(s) 409, 552
BspTNI GGTCTC 1 cut(s) 13
BsrBI CCGCTC 1 cut(s) 125
BsrI ACTGG 1 cut(s) 611
BssECI CCNNGG 2 cut(s) 397, 505
BssMI GATC 6 cut(s) 199, 288, 379, 401, 475, 544
BssSI CACGAG 1 cut(s) 273
BssT1I CCWWGG 1 cut(s) 397
Bst2BI CACGAG 1 cut(s) 273
Bst2UI CCWGG 1 cut(s) 507
Bst4CI ACNGT 1 cut(s) 368
Bst6I CTCTTC 1 cut(s) 134
BstBAI YACGTR 2 cut(s) 221, 263
BstC8I GCNNGC 2 cut(s) 49, 390
BstDEI CTNAG 2 cut(s) 76, 540
BstF5I GGATG 3 cut(s) 202, 230, 502
BstFNI CGCG 1 cut(s) 194
BstKTI GATC 6 cut(s) 202, 291, 382, 404, 478, 547
BstMAI GTCTC 2 cut(s) 13, 88
BstMBI GATC 6 cut(s) 199, 288, 379, 401, 475, 544
BstMWI GCNNNNNNNGC 2 cut(s) 307, 437
BstNI CCWGG 1 cut(s) 507
BstSCI CCNGG 1 cut(s) 505
BstSFI CTRYAG 2 cut(s) 305, 566
BstUI CGCG 1 cut(s) 194
BstV1I GCAGC 2 cut(s) 98, 606
BstV2I GAAGAC 1 cut(s) 317
BstX2I RGATCY 1 cut(s) 544
BstYI RGATCY 1 cut(s) 544
BsuRI GGCC 1 cut(s) 440
BtgZI GCGATG 2 cut(s) 253, 539
BtsCI GGATG 3 cut(s) 202, 230, 502
Cac8I GCNNGC 2 cut(s) 49, 390
CseI GACGC 1 cut(s) 53
DdeI CTNAG 2 cut(s) 76, 540
DpnI GATC 6 cut(s) 201, 290, 381, 403, 477, 546
DpnII GATC 6 cut(s) 199, 288, 379, 401, 475, 544
DraIII CACNNNGTG 1 cut(s) 263
EaeI YGGCCR 1 cut(s) 438
Eam1104I CTCTTC 1 cut(s) 134
EarI CTCTTC 1 cut(s) 134
Eco130I CCWWGG 1 cut(s) 397
Eco31I GGTCTC 1 cut(s) 13
Eco57I CTGAAG 2 cut(s) 77, 129
Eco72I CACGTG 2 cut(s) 221, 263
EcoRII CCWGG 1 cut(s) 505
EcoT14I CCWWGG 1 cut(s) 397
ErhI CCWWGG 1 cut(s) 397
FaiI YATR 1 cut(s) 344
FaqI GGGAC 1 cut(s) 56
FbaI TGATCA 1 cut(s) 199
Fnu4HI GCNGC 3 cut(s) 112, 123, 595
FokI GGATG 3 cut(s) 209, 217, 509
Fsp4HI GCNGC 3 cut(s) 112, 123, 595
FspBI CTAG 1 cut(s) 622
GluI GCNGC 3 cut(s) 112, 123, 595
HaeIII GGCC 1 cut(s) 440
HgaI GACGC 1 cut(s) 53
HincII GTYRAC 1 cut(s) 340
HindII GTYRAC 1 cut(s) 340
HindIII AAGCTT 1 cut(s) 299
HinfI GANTC 2 cut(s) 227, 373
HphI GGTGA 4 cut(s) 124, 156, 249, 547
Hpy166II GTNNAC 2 cut(s) 22, 340
Hpy188I TCNGA 6 cut(s) 79, 148, 178, 288, 454, 480
Hpy188III TCNNGA 5 cut(s) 23, 95, 377, 490, 525
Hpy8I GTNNAC 2 cut(s) 22, 340
Hpy99I CGWCG 2 cut(s) 29, 32
HpyCH4III ACNGT 1 cut(s) 368
HpyCH4IV ACGT 2 cut(s) 220, 262
HpyCH4V TGCA 2 cut(s) 431, 568
HpyF10VI GCNNNNNNNGC 2 cut(s) 307, 437
HpyF3I CTNAG 2 cut(s) 76, 540
HpySE526I ACGT 2 cut(s) 220, 262
Ksp22I TGATCA 1 cut(s) 199
Kzo9I GATC 6 cut(s) 199, 288, 379, 401, 475, 544
LmnI GCTCC 1 cut(s) 555
LpnPI CCDG 5 cut(s) 492, 503, 519, 592, 595
Lsp1109I GCAGC 2 cut(s) 98, 606
MaeI CTAG 1 cut(s) 622
MaeII ACGT 2 cut(s) 220, 262
MaeIII GTNAC 2 cut(s) 263, 535
MalI GATC 6 cut(s) 201, 290, 381, 403, 477, 546
MbiI CCGCTC 1 cut(s) 125
MboI GATC 6 cut(s) 199, 288, 379, 401, 475, 544
MboII GAAGA 5 cut(s) 70, 110, 121, 317, 493
MfeI CAATTG 1 cut(s) 420
MflI RGATCY 1 cut(s) 544
MhlI GDGCHC 1 cut(s) 390
MluCI AATT 1 cut(s) 420
MroXI GAANNNNTTC 1 cut(s) 485
MslI CAYNNNNRTG 1 cut(s) 195
MspR9I CCNGG 1 cut(s) 507
MunI CAATTG 1 cut(s) 420
MvaI CCWGG 1 cut(s) 507
MvnI CGCG 1 cut(s) 194
MwoI GCNNNNNNNGC 2 cut(s) 307, 437
NdeII GATC 6 cut(s) 199, 288, 379, 401, 475, 544
NmuCI GTSAC 2 cut(s) 263, 535
PdmI GAANNNNTTC 1 cut(s) 485
PfeI GAWTC 2 cut(s) 227, 373
PkrI GCNGC 3 cut(s) 113, 124, 596
PmaCI CACGTG 2 cut(s) 221, 263
PmlI CACGTG 2 cut(s) 221, 263
Ppu21I YACGTR 2 cut(s) 221, 263
Psp6I CCWGG 1 cut(s) 505
PspCI CACGTG 2 cut(s) 221, 263
PspGI CCWGG 1 cut(s) 505
PstI CTGCAG 1 cut(s) 570
PsuI RGATCY 1 cut(s) 544
RseI CAYNNNNRTG 1 cut(s) 195
SatI GCNGC 3 cut(s) 112, 123, 595
Sau3AI GATC 6 cut(s) 199, 288, 379, 401, 475, 544
ScrFI CCNGG 1 cut(s) 507
SduI GDGCHC 1 cut(s) 390
SfcI CTRYAG 2 cut(s) 305, 566
SmiMI CAYNNNNRTG 1 cut(s) 195
Sse9I AATT 1 cut(s) 420
SsiI CCGC 2 cut(s) 123, 194
SspMI CTAG 1 cut(s) 622
StyD4I CCNGG 1 cut(s) 505
StyI CCWWGG 1 cut(s) 397
TaaI ACNGT 1 cut(s) 368
TaiI ACGT 2 cut(s) 223, 265
TasI AATT 1 cut(s) 420
TauI GCSGC 1 cut(s) 125
TfiI GAWTC 2 cut(s) 227, 373
TseFI GTSAC 2 cut(s) 263, 535
TseI GCWGC 2 cut(s) 111, 594
Tsp45I GTSAC 2 cut(s) 263, 535
TspDTI ATGAA 1 cut(s) 219
XmnI GAANNNNTTC 1 cut(s) 485
XspI CTAG 1 cut(s) 622
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.