Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0001850

Physical Location & Seq

Genomic Coordinates Forward (+)

54420921 .. 54421417

Gene Structure 497 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00204930.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 225 bp

ATGACTTGGTTGAAACTTGTGCTTTGTAGGACTGAGATAGAATGGTATAGCAGAACACGTTTGACACCAAAGCTCAATGAGAAGAGGCTTTATGTGGGCACTAACAATTGGGGAAGTTTCTTCAACTTTTTCAGTCCACCCCAAGTCCCCGAGTTAAAGATGGAAAAGCGGTCAACCATTCAAGAGGTCATTCCCCATGCTGTGTCATGGTTTGCAAAAAAGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NAP

Protein Analysis

74

Amino Acids

8.9

Weight (kDa)

9.92

Isoelectric Point (pI)

43.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001850)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0057701 RchiOBHm_Chr6g0278381
rosa_multiflora	Rmu_sc0002080.1_g000035 Rmu_sc0002482.1_g000015 Rmu_sc0003837.1_g000009 Rmu_sc0005852.1_g000009 Rmu_sc0006325.1_g000033 Rmu_sc0009634.1_g000001 Rmu_ssc0000435.1_g000003
rosa_roxburghii	Rroxscaffold_1G00033310 Rroxscaffold_2G00097210 Rroxscaffold_2G00100530 Rroxscaffold_3G00222980 Rroxscaffold_3G00223140 Rroxscaffold_4G00283070 Rroxscaffold_4G00302540 Rroxscaffold_5G00334950 Rroxscaffold_5G00336780 Rroxscaffold_5G00337950 Rroxscaffold_5G00358620 Rroxscaffold_5G00367500 Rroxscaffold_6G00401010 Rroxscaffold_6G00401040 Rroxscaffold_7G00179780 Rroxscaffold_7G00190410 Rroxscaffold_7G00190420 Rroxscaffold_7G00204930
rosa_rugosa	Rorug05G0490900.1 Rorug06G0116200
rosa_samantha	Rh1AG219300 Rh1BG343800 Rh1CG203800 Rh2BG515200 Rh2DG527300 Rh5CG412400 Rh6AG225900 Rh6AG229500 Rh6BG229900 Rh6BG240600 Rh6CG233100 Rh6DG224300 Rh7BG250000 Rh7CG511800 Rh7DG478500
rosa_wichuraiana	Rw6G007070 Rw6G019700 Rw6G020090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	169
AflIII	ACRYGT	1 cut(s)	56
AgsI	TTSAA	3 cut(s)	13, 124, 182
AluBI	AGCT	1 cut(s)	73
AluI	AGCT	1 cut(s)	73
Ama87I	CYCGRG	1 cut(s)	149
AvaI	CYCGRG	1 cut(s)	149
BaeGI	GKGCMC	1 cut(s)	101
BccI	CCATC	1 cut(s)	154
BmeT110I	CYCGRG	1 cut(s)	149
BseMII	CTCAG	1 cut(s)	24
BseSI	GKGCMC	1 cut(s)	101
BsiHKCI	CYCGRG	1 cut(s)	149
BslFI	GGGAC	1 cut(s)	131
BsmFI	GGGAC	1 cut(s)	131
BsoBI	CYCGRG	1 cut(s)	149
Bsp1286I	GDGCHC	1 cut(s)	101
BspACI	CCGC	1 cut(s)	169
BspCNI	CTCAG	1 cut(s)	25
Bst6I	CTCTTC	1 cut(s)	77
BstDEI	CTNAG	1 cut(s)	33
BstSLI	GKGCMC	1 cut(s)	101
CviAII	CATG	2 cut(s)	197, 207
CviJI	RGCY	2 cut(s)	73, 88
CviKI_1	RGCY	2 cut(s)	73, 88
DdeI	CTNAG	1 cut(s)	33
Eam1104I	CTCTTC	1 cut(s)	77
EarI	CTCTTC	1 cut(s)	77
Eco88I	CYCGRG	1 cut(s)	149
FaeI	CATG	2 cut(s)	200, 210
FaiI	YATR	4 cut(s)	48, 93, 198, 208
FaqI	GGGAC	1 cut(s)	131
FatI	CATG	2 cut(s)	196, 206
Hin1II	CATG	2 cut(s)	200, 210
HincII	GTYRAC	1 cut(s)	174
HindII	GTYRAC	1 cut(s)	174
Hpy166II	GTNNAC	2 cut(s)	137, 174
Hpy188III	TCNNGA	1 cut(s)	182
Hpy8I	GTNNAC	2 cut(s)	137, 174
HpyCH4IV	ACGT	1 cut(s)	58
HpyCH4V	TGCA	1 cut(s)	215
HpyF3I	CTNAG	1 cut(s)	33
HpySE526I	ACGT	1 cut(s)	58
Hsp92II	CATG	2 cut(s)	200, 210
MaeII	ACGT	1 cut(s)	58
MboII	GAAGA	2 cut(s)	94, 112
MfeI	CAATTG	1 cut(s)	106
MhlI	GDGCHC	1 cut(s)	101
MluCI	AATT	1 cut(s)	106
MnlI	CCTC	2 cut(s)	78, 178
MseI	TTAA	1 cut(s)	155
MunI	CAATTG	1 cut(s)	106
NlaIII	CATG	2 cut(s)	200, 210
SaqAI	TTAA	1 cut(s)	155
SduI	GDGCHC	1 cut(s)	101
SetI	ASST	3 cut(s)	61, 75, 189
SgeI	CNNG	9 cut(s)	18, 29, 69, 155, 161, 163, 194, 209, 219
Sse9I	AATT	1 cut(s)	106
SsiI	CCGC	1 cut(s)	169
TaiI	ACGT	1 cut(s)	61
TasI	AATT	1 cut(s)	106
Tru1I	TTAA	1 cut(s)	155
Tru9I	TTAA	1 cut(s)	155

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.