Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000006

Orthogroup ID

OG0001850

Physical Location & Seq

Genomic Coordinates Reverse (-)

23278556 .. 23282182

Gene Structure 3627 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_6G00401040.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 222 bp

ATGGGCCCCACCGAAAGTTCCAAACCTCGTGAAGACTTCCCTAGTATGACTGAGATAGAATGGTATAGCAGAACACGTTTGACACCAAAGCTCAATGAGAAGAGGCTTTATGTGGGCACTAACAATTGGGGAAGTTTCTTCAACTTTTTCAGTCCACCCCAAGTCCCCGCAGTTATAGATGGAAAAGCGTGGACCAACTTCTGCCACCTCTCTCCTCGGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000150 GO:0000217 GO:0000400 GO:0000724 GO:0000725 GO:0000730 GO:0003674 GO:0003676 GO:0003677 GO:0003690 GO:0003697 GO:0003824 GO:0005488 GO:0006139 GO:0006259 GO:0006281 GO:0006302 GO:0006310 GO:0006312 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008094 GO:0008150 GO:0008152 GO:0009314 GO:0009628 GO:0009987 GO:0010212 GO:0016043 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022607 GO:0033554 GO:0034622 GO:0034641 GO:0042148 GO:0042623 GO:0043170 GO:0043933 GO:0044085 GO:0044237 GO:0044238 GO:0044260 GO:0045003 GO:0046483 GO:0050896 GO:0051716 GO:0065003 GO:0065004 GO:0071704 GO:0071824 GO:0071840 GO:0090304 GO:0090735 GO:0097159 GO:0140097 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NAP

Protein Analysis

73

Amino Acids

8.5

Weight (kDa)

8.98

Isoelectric Point (pI)

45.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001850)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0057701 RchiOBHm_Chr6g0278381
rosa_multiflora	Rmu_sc0002080.1_g000035 Rmu_sc0002482.1_g000015 Rmu_sc0003837.1_g000009 Rmu_sc0005852.1_g000009 Rmu_sc0006325.1_g000033 Rmu_sc0009634.1_g000001 Rmu_ssc0000435.1_g000003
rosa_roxburghii	Rroxscaffold_1G00033310 Rroxscaffold_2G00097210 Rroxscaffold_2G00100530 Rroxscaffold_3G00222980 Rroxscaffold_3G00223140 Rroxscaffold_4G00283070 Rroxscaffold_4G00302540 Rroxscaffold_5G00334950 Rroxscaffold_5G00336780 Rroxscaffold_5G00337950 Rroxscaffold_5G00358620 Rroxscaffold_5G00367500 Rroxscaffold_6G00401010 Rroxscaffold_6G00401040 Rroxscaffold_7G00179780 Rroxscaffold_7G00190410 Rroxscaffold_7G00190420 Rroxscaffold_7G00204930
rosa_rugosa	Rorug05G0490900.1 Rorug06G0116200
rosa_samantha	Rh1AG219300 Rh1BG343800 Rh1CG203800 Rh2BG515200 Rh2DG527300 Rh5CG412400 Rh6AG225900 Rh6AG229500 Rh6BG229900 Rh6BG240600 Rh6CG233100 Rh6DG224300 Rh7BG250000 Rh7CG511800 Rh7DG478500
rosa_wichuraiana	Rw6G007070 Rw6G019700 Rw6G020090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	168
AflIII	ACRYGT	1 cut(s)	74
AgsI	TTSAA	1 cut(s)	142
AluBI	AGCT	1 cut(s)	91
AluI	AGCT	1 cut(s)	91
AoxI	GGCC	1 cut(s)	4
ApaI	GGGCCC	1 cut(s)	8
AspS9I	GGNCC	3 cut(s)	4, 5, 192
AvaII	GGWCC	1 cut(s)	192
BaeGI	GKGCMC	2 cut(s)	8, 119
BanII	GRGCYC	1 cut(s)	8
BauI	CACGAG	1 cut(s)	27
BbsI	GAAGAC	1 cut(s)	39
BccI	CCATC	1 cut(s)	173
BfaI	CTAG	1 cut(s)	42
Bme18I	GGWCC	1 cut(s)	192
BmgT120I	GGNCC	3 cut(s)	4, 5, 192
BmiI	GGNNCC	2 cut(s)	6, 7
BpiI	GAAGAC	1 cut(s)	39
BsaJI	CCNNGG	1 cut(s)	215
BseDI	CCNNGG	1 cut(s)	215
BseMII	CTCAG	1 cut(s)	42
BseRI	GAGGAG	1 cut(s)	204
BseSI	GKGCMC	2 cut(s)	8, 119
BshFI	GGCC	1 cut(s)	6
BslFI	GGGAC	1 cut(s)	149
BsmFI	GGGAC	1 cut(s)	149
BsnI	GGCC	1 cut(s)	6
Bsp120I	GGGCCC	1 cut(s)	4
Bsp1286I	GDGCHC	2 cut(s)	8, 119
BspACI	CCGC	1 cut(s)	168
BspANI	GGCC	1 cut(s)	6
BspCNI	CTCAG	1 cut(s)	43
BspLI	GGNNCC	2 cut(s)	6, 7
BssECI	CCNNGG	1 cut(s)	215
BssSI	CACGAG	1 cut(s)	27
Bst2BI	CACGAG	1 cut(s)	27
Bst6I	CTCTTC	1 cut(s)	95
BstDEI	CTNAG	1 cut(s)	51
BstSLI	GKGCMC	2 cut(s)	8, 119
BstV2I	GAAGAC	1 cut(s)	39
BsuRI	GGCC	1 cut(s)	6
Cfr13I	GGNCC	3 cut(s)	4, 5, 192
CviJI	RGCY	3 cut(s)	6, 91, 106
CviKI_1	RGCY	3 cut(s)	6, 91, 106
DdeI	CTNAG	1 cut(s)	51
Eam1104I	CTCTTC	1 cut(s)	95
EarI	CTCTTC	1 cut(s)	95
Eco24I	GRGCYC	1 cut(s)	8
Eco47I	GGWCC	1 cut(s)	192
EcoO109I	RGGNCCY	1 cut(s)	5
EcoT38I	GRGCYC	1 cut(s)	8
FaiI	YATR	4 cut(s)	47, 66, 111, 176
FaqI	GGGAC	1 cut(s)	149
FauI	CCCGC	1 cut(s)	175
FriOI	GRGCYC	1 cut(s)	8
FspBI	CTAG	1 cut(s)	42
HaeIII	GGCC	1 cut(s)	6
Hpy166II	GTNNAC	2 cut(s)	155, 192
Hpy188III	TCNNGA	1 cut(s)	29
Hpy8I	GTNNAC	2 cut(s)	155, 192
HpyCH4IV	ACGT	1 cut(s)	76
HpyF3I	CTNAG	1 cut(s)	51
HpySE526I	ACGT	1 cut(s)	76
MaeI	CTAG	1 cut(s)	42
MaeII	ACGT	1 cut(s)	76
MboII	GAAGA	3 cut(s)	44, 112, 130
MfeI	CAATTG	1 cut(s)	124
MhlI	GDGCHC	2 cut(s)	8, 119
MluCI	AATT	1 cut(s)	124
MnlI	CCTC	3 cut(s)	36, 96, 218
MunI	CAATTG	1 cut(s)	124
NlaIV	GGNNCC	2 cut(s)	6, 7
PspN4I	GGNNCC	2 cut(s)	6, 7
PspOMI	GGGCCC	1 cut(s)	4
PspPI	GGNCC	3 cut(s)	4, 5, 192
Sau96I	GGNCC	3 cut(s)	4, 5, 192
SduI	GDGCHC	2 cut(s)	8, 119
SetI	ASST	4 cut(s)	28, 79, 93, 210
SgeI	CNNG	7 cut(s)	39, 41, 54, 87, 173, 179, 201
SinI	GGWCC	1 cut(s)	192
Sse9I	AATT	1 cut(s)	124
SsiI	CCGC	1 cut(s)	168
SspMI	CTAG	1 cut(s)	42
TaiI	ACGT	1 cut(s)	79
TasI	AATT	1 cut(s)	124
VpaK11BI	GGWCC	1 cut(s)	192
XspI	CTAG	1 cut(s)	42

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.