Rroxscaffold_3G00222980

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0001850
Physical Location & Seq
Forward (+)
6084200 .. 6097123
12924 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00222980.1

Sequence Viewer

Length: 468 bp
ATGGCTCCAAGGCATATTCTAGCTCGTAGGCCAATCCTCGAGAGGCATACCGTCTTGCTTGTTGGTATGCCGCTCGAAATCAAACAAAACCAAGCTCTACAACTCGAGATATACCTAATCGAAGGTTTCGGGTGCAACGGGTTCGAGTTCCGGCCGCTTCCGAGCGGCGGCGCCGTGCGGGGTGGTTCGGGAGCTTCGAAGGTCAAGGCGAACCTGTGGGTGAAGTTTGGGAAGGTTTCGTGGCACGTAGCTCGAGTCACCATACTTGGAACCAAATCGGGGCCGTACGAACCCTATCCCTTCGCCGCCGTTCCGGTGAGGCGTGACCCAAGACGCCACGGTGGCTTCGCAAGGCGAGGCGAATCTCTTGGAGGTTGTTTGGCGTCAAATGATGACCTGTGGTGGAAGGGGGAGATCGGAGAACAAGAAAACGATGTTACGAAAATCTACGGACATCGTTTTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

155

Amino Acids

17.28

Weight (kDa)

9.87

Isoelectric Point (pI)

58.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 170
AccBSI CCGCTC 2 cut(s) 73, 165
AciI CCGC 6 cut(s) 71, 155, 165, 168, 178, 306
AcoI YGGCCR 1 cut(s) 152
AcyI GRCGYC 3 cut(s) 171, 334, 383
AfaI GTAC 1 cut(s) 287
AfiI CCNNNNNNNGG 2 cut(s) 167, 279
AluBI AGCT 4 cut(s) 23, 95, 194, 251
AluI AGCT 4 cut(s) 23, 95, 194, 251
Ama87I CYCGRG 3 cut(s) 38, 104, 252
AoxI GGCC 3 cut(s) 29, 152, 281
AspLEI GCGC 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 281
AsuHPI GGTGA 3 cut(s) 232, 250, 328
AsuII TTCGAA 1 cut(s) 197
AvaI CYCGRG 3 cut(s) 38, 104, 252
BanI GGYRCC 1 cut(s) 170
BceAI ACGGC 3 cut(s) 158, 268, 293
BcgI CGANNNNNNTGC 4 cut(s) 124, 158, 233, 267
BfaI CTAG 1 cut(s) 20
BfoI RGCGCY 1 cut(s) 174
BglI GCCNNNNNGGC 1 cut(s) 342
BisI GCNGC 5 cut(s) 71, 155, 166, 169, 306
BlsI GCNGC 5 cut(s) 72, 156, 167, 170, 307
BmeT110I CYCGRG 3 cut(s) 38, 104, 252
BmgT120I GGNCC 1 cut(s) 281
BmiI GGNNCC 4 cut(s) 6, 172, 271, 282
Bpu14I TTCGAA 1 cut(s) 197
BsaAI YACGTR 1 cut(s) 247
BsaHI GRCGYC 3 cut(s) 171, 334, 383
BsaJI CCNNGG 2 cut(s) 8, 337
BsaWI WCCGGW 1 cut(s) 313
Bsc4I CCNNNNNNNGG 2 cut(s) 167, 279
BseDI CCNNGG 2 cut(s) 8, 337
BseLI CCNNNNNNNGG 2 cut(s) 167, 279
BseX3I CGGCCG 1 cut(s) 152
Bsh1285I CGRYCG 1 cut(s) 155
BshFI GGCC 3 cut(s) 31, 154, 283
BshNI GGYRCC 1 cut(s) 170
BsiEI CGRYCG 1 cut(s) 155
BsiHKCI CYCGRG 3 cut(s) 38, 104, 252
BsiSI CCGG 2 cut(s) 151, 314
BsiWI CGTACG 1 cut(s) 285
BslI CCNNNNNNNGG 2 cut(s) 167, 279
BsnI GGCC 3 cut(s) 31, 154, 283
BsoBI CYCGRG 3 cut(s) 38, 104, 252
Bsp119I TTCGAA 1 cut(s) 197
Bsp143I GATC 1 cut(s) 414
BspACI CCGC 6 cut(s) 71, 155, 165, 168, 178, 306
BspANI GGCC 3 cut(s) 31, 154, 283
BspLI GGNNCC 4 cut(s) 6, 172, 271, 282
BspT104I TTCGAA 1 cut(s) 197
BspT107I GGYRCC 1 cut(s) 170
BsrBI CCGCTC 2 cut(s) 73, 165
BssECI CCNNGG 2 cut(s) 8, 337
BssMI GATC 1 cut(s) 414
BssNI GRCGYC 3 cut(s) 171, 334, 383
BssT1I CCWWGG 1 cut(s) 8
Bst4CI ACNGT 2 cut(s) 52, 341
BstACI GRCGYC 3 cut(s) 171, 334, 383
BstBAI YACGTR 1 cut(s) 247
BstBI TTCGAA 1 cut(s) 197
BstDSI CCRYGG 1 cut(s) 337
BstH2I RGCGCY 1 cut(s) 174
BstHHI GCGC 1 cut(s) 173
BstKTI GATC 1 cut(s) 417
BstMBI GATC 1 cut(s) 414
BstMCI CGRYCG 1 cut(s) 155
BstMWI GCNNNNNNNGC 1 cut(s) 342
BstZI CGGCCG 1 cut(s) 152
BsuRI GGCC 3 cut(s) 31, 154, 283
BtgI CCRYGG 1 cut(s) 337
CfoI GCGC 1 cut(s) 173
Cfr13I GGNCC 1 cut(s) 281
CseI GACGC 2 cut(s) 342, 372
Csp6I GTAC 1 cut(s) 286
CviJI RGCY 9 cut(s) 5, 23, 31, 95, 154, 194, 251, 283, 345
CviKI_1 RGCY 9 cut(s) 5, 23, 31, 95, 154, 194, 251, 283, 345
CviQI GTAC 1 cut(s) 286
DinI GGCGCC 1 cut(s) 172
DpnI GATC 1 cut(s) 416
DpnII GATC 1 cut(s) 414
EaeI YGGCCR 1 cut(s) 152
EagI CGGCCG 1 cut(s) 152
EclXI CGGCCG 1 cut(s) 152
Eco130I CCWWGG 1 cut(s) 8
Eco52I CGGCCG 1 cut(s) 152
Eco88I CYCGRG 3 cut(s) 38, 104, 252
EcoT14I CCWWGG 1 cut(s) 8
EgeI GGCGCC 1 cut(s) 172
EheI GGCGCC 1 cut(s) 172
ErhI CCWWGG 1 cut(s) 8
FaiI YATR 5 cut(s) 15, 48, 68, 112, 263
FauI CCCGC 1 cut(s) 171
Fnu4HI GCNGC 5 cut(s) 71, 155, 166, 169, 306
Fsp4HI GCNGC 5 cut(s) 71, 155, 166, 169, 306
FspBI CTAG 1 cut(s) 20
GlaI GCGC 1 cut(s) 172
GluI GCNGC 5 cut(s) 71, 155, 166, 169, 306
HaeII RGCGCY 1 cut(s) 174
HaeIII GGCC 3 cut(s) 31, 154, 283
HapII CCGG 2 cut(s) 151, 314
HgaI GACGC 2 cut(s) 342, 372
HhaI GCGC 1 cut(s) 173
Hin1I GRCGYC 3 cut(s) 171, 334, 383
Hin6I GCGC 1 cut(s) 171
HinP1I GCGC 1 cut(s) 171
HinfI GANTC 2 cut(s) 255, 362
HpaII CCGG 2 cut(s) 151, 314
HphI GGTGA 3 cut(s) 232, 250, 328
Hpy188I TCNGA 2 cut(s) 162, 419
Hpy188III TCNNGA 3 cut(s) 40, 106, 189
HpyAV CCTTC 5 cut(s) 116, 193, 226, 310, 400
HpyCH4III ACNGT 2 cut(s) 52, 341
HpyCH4IV ACGT 1 cut(s) 246
HpyCH4V TGCA 1 cut(s) 135
HpyF10VI GCNNNNNNNGC 1 cut(s) 342
HpySE526I ACGT 1 cut(s) 246
Hsp92I GRCGYC 3 cut(s) 171, 334, 383
HspAI GCGC 1 cut(s) 171
KasI GGCGCC 1 cut(s) 170
Kzo9I GATC 1 cut(s) 414
LmnI GCTCC 2 cut(s) 10, 191
LpnPI CCDG 4 cut(s) 164, 227, 327, 410
MaeI CTAG 1 cut(s) 20
MaeII ACGT 1 cut(s) 246
MaeIII GTNAC 3 cut(s) 256, 323, 436
MalI GATC 1 cut(s) 416
MbiI CCGCTC 2 cut(s) 73, 165
MboI GATC 1 cut(s) 414
Mly113I GGCGCC 1 cut(s) 171
MlyI GAGTC 1 cut(s) 264
MnlI CCTC 5 cut(s) 36, 47, 312, 350, 365
MseI TTAA 1 cut(s) 466
MspI CCGG 2 cut(s) 151, 314
MwoI GCNNNNNNNGC 1 cut(s) 342
NarI GGCGCC 1 cut(s) 171
NdeII GATC 1 cut(s) 414
NlaIV GGNNCC 4 cut(s) 6, 172, 271, 282
NmuCI GTSAC 2 cut(s) 256, 323
NspV TTCGAA 1 cut(s) 197
PaeR7I CTCGAG 3 cut(s) 38, 104, 252
PcsI WCGNNNNNNNCGW 1 cut(s) 194
PfeI GAWTC 1 cut(s) 362
Pfl23II CGTACG 1 cut(s) 285
PkrI GCNGC 5 cut(s) 72, 156, 167, 170, 307
PleI GAGTC 1 cut(s) 263
PluTI GGCGCC 1 cut(s) 174
PpsI GAGTC 1 cut(s) 263
Ppu21I YACGTR 1 cut(s) 247
PspLI CGTACG 1 cut(s) 285
PspN4I GGNNCC 4 cut(s) 6, 172, 271, 282
PspPI GGNCC 1 cut(s) 281
PspXI VCTCGAGB 1 cut(s) 252
RsaI GTAC 1 cut(s) 287
RsaNI GTAC 1 cut(s) 286
SaqAI TTAA 1 cut(s) 466
SatI GCNGC 5 cut(s) 71, 155, 166, 169, 306
Sau3AI GATC 1 cut(s) 414
Sau96I GGNCC 1 cut(s) 281
SchI GAGTC 1 cut(s) 264
SfoI GGCGCC 1 cut(s) 172
Sfr274I CTCGAG 3 cut(s) 38, 104, 252
SfuI TTCGAA 1 cut(s) 197
SlaI CTCGAG 3 cut(s) 38, 104, 252
SmlI CTYRAG 3 cut(s) 38, 104, 252
SmoI CTYRAG 3 cut(s) 38, 104, 252
SsiI CCGC 6 cut(s) 71, 155, 165, 168, 178, 306
SspDI GGCGCC 1 cut(s) 170
SspMI CTAG 1 cut(s) 20
StyI CCWWGG 1 cut(s) 8
TaaI ACNGT 2 cut(s) 52, 341
TaiI ACGT 1 cut(s) 249
TaqI TCGA 7 cut(s) 39, 75, 105, 120, 144, 197, 253
TauI GCSGC 5 cut(s) 73, 157, 168, 171, 308
TfiI GAWTC 1 cut(s) 362
Tru1I TTAA 1 cut(s) 466
Tru9I TTAA 1 cut(s) 466
TseFI GTSAC 2 cut(s) 256, 323
Tsp45I GTSAC 2 cut(s) 256, 323
TspGWI ACGGA 1 cut(s) 465
XhoI CTCGAG 3 cut(s) 38, 104, 252
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.