Rh1CG203800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
44189069 .. 44208489
19421 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG203800.1

Sequence Viewer

Length: 198 bp
ATGGTGGTTGGAAGTTCAAATTCAGCCTCTTATGCAGGAATCAACATCAATTTTGCTTCAATGAACACTTTCACCAAAGCTGAGGAAGTGAGGAGCCGTATTGCTTCAGGCACCACACACCAGTATGAAATGCAAAGATTGAAACAGGGACAACACCTCCTGAACCCCTTTAAGTGTCAATGGTCCAGGGATGCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.3

Weight (kDa)

9.51

Isoelectric Point (pI)

33.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 110
AcsI RAATTY 1 cut(s) 19
AcuI CTGAAG 1 cut(s) 90
AgsI TTSAA 3 cut(s) 18, 60, 142
AjnI CCWGG 1 cut(s) 185
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
ApoI RAATTY 1 cut(s) 19
Asp700I GAANNNNTTC 1 cut(s) 68
AspS9I GGNCC 1 cut(s) 183
AsuHPI GGTGA 1 cut(s) 64
AvaII GGWCC 1 cut(s) 183
BanI GGYRCC 1 cut(s) 110
BbvCI CCTCAGC 1 cut(s) 81
BceAI ACGGC 1 cut(s) 81
BciT130I CCWGG 1 cut(s) 187
Bme1390I CCNGG 1 cut(s) 187
Bme18I GGWCC 1 cut(s) 183
BmgT120I GGNCC 1 cut(s) 183
BmiI GGNNCC 2 cut(s) 95, 112
BmrFI CCNGG 1 cut(s) 187
BmsI GCATC 1 cut(s) 181
Bpu10I CCTNAGC 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 186
BsaXI ACNNNNNCTCC 2 cut(s) 141, 171
Bse1I ACTGG 1 cut(s) 121
BseBI CCWGG 1 cut(s) 187
BseDI CCNNGG 1 cut(s) 186
BseGI GGATG 1 cut(s) 196
BseMII CTCAG 1 cut(s) 72
BseNI ACTGG 1 cut(s) 121
BseRI GAGGAG 1 cut(s) 106
BshNI GGYRCC 1 cut(s) 110
BslFI GGGAC 1 cut(s) 162
BsmFI GGGAC 1 cut(s) 162
BspCNI CTCAG 1 cut(s) 73
BspLI GGNNCC 2 cut(s) 95, 112
BspT107I GGYRCC 1 cut(s) 110
BsrI ACTGG 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 186
Bst2UI CCWGG 1 cut(s) 187
BstDEI CTNAG 1 cut(s) 81
BstF5I GGATG 1 cut(s) 196
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstNI CCWGG 1 cut(s) 187
BstSCI CCNGG 1 cut(s) 185
BtsCI GGATG 1 cut(s) 196
Cfr13I GGNCC 1 cut(s) 183
CviJI RGCY 3 cut(s) 26, 80, 96
CviKI_1 RGCY 3 cut(s) 26, 80, 96
DdeI CTNAG 1 cut(s) 81
Eco47I GGWCC 1 cut(s) 183
Eco57I CTGAAG 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 185
FaiI YATR 2 cut(s) 33, 126
FaqI GGGAC 1 cut(s) 162
HinfI GANTC 1 cut(s) 39
HphI GGTGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 160
HpyCH4V TGCA 2 cut(s) 35, 133
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 81
LmnI GCTCC 1 cut(s) 93
LpnPI CCDG 6 cut(s) 21, 93, 131, 134, 172, 173
LweI GCATC 1 cut(s) 181
MluCI AATT 2 cut(s) 19, 49
MnlI CCTC 4 cut(s) 37, 76, 84, 167
MroXI GAANNNNTTC 1 cut(s) 68
MseI TTAA 1 cut(s) 171
MslI CAYNNNNRTG 1 cut(s) 123
MspR9I CCNGG 1 cut(s) 187
MvaI CCWGG 1 cut(s) 187
MwoI GCNNNNNNNGC 1 cut(s) 32
NlaIV GGNNCC 2 cut(s) 95, 112
PdmI GAANNNNTTC 1 cut(s) 68
PfeI GAWTC 1 cut(s) 39
Psp6I CCWGG 1 cut(s) 185
PspGI CCWGG 1 cut(s) 185
PspN4I GGNNCC 2 cut(s) 95, 112
PspPI GGNCC 1 cut(s) 183
RseI CAYNNNNRTG 1 cut(s) 123
SaqAI TTAA 1 cut(s) 171
Sau96I GGNCC 1 cut(s) 183
ScrFI CCNGG 1 cut(s) 187
SetI ASST 2 cut(s) 82, 159
SfaNI GCATC 1 cut(s) 181
SgeI CNNG 5 cut(s) 48, 120, 133, 158, 172
SinI GGWCC 1 cut(s) 183
SmiMI CAYNNNNRTG 1 cut(s) 123
Sse9I AATT 2 cut(s) 19, 49
StyD4I CCNGG 1 cut(s) 185
TasI AATT 2 cut(s) 19, 49
TfiI GAWTC 1 cut(s) 39
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TspDTI ATGAA 2 cut(s) 77, 141
VpaK11BI GGWCC 1 cut(s) 183
XapI RAATTY 1 cut(s) 19
XmnI GAANNNNTTC 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.