RchiOBHm_Chr6g0260041

Long chain acyl-CoA synthetase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
15163908 .. 15166776
2869 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23318

Sequence Viewer

Length: 171 bp
ATGTATGAACCAGTTGATGCTCAAACCTCAGAAGAACGTATGTGTGTTCTGAGTCCTAGAGATCGTTGTGGTATATATGGATCAAATTGCTCCCAATGGATTATTGCAATGGAGATTTTGAACCTCGATATGTTTTTAAAGACGATGGAGAGAGAGGTTAGAAGAAGATGA

Protein Analysis

56

Amino Acids

6.67

Weight (kDa)

5.25

Isoelectric Point (pI)

55.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 88
AgsI TTSAA 1 cut(s) 121
AlwI GGATC 1 cut(s) 88
BccI CCATC 1 cut(s) 139
BfaI CTAG 1 cut(s) 57
BmsI GCATC 1 cut(s) 7
Bse1I ACTGG 1 cut(s) 11
Bse3DI GCAATG 1 cut(s) 114
BseMI GCAATG 1 cut(s) 114
BseMII CTCAG 2 cut(s) 41, 42
BseNI ACTGG 1 cut(s) 11
Bsp143I GATC 2 cut(s) 61, 80
BspCNI CTCAG 2 cut(s) 41, 42
BspPI GGATC 1 cut(s) 88
BsrDI GCAATG 1 cut(s) 114
BsrI ACTGG 1 cut(s) 11
BssMI GATC 2 cut(s) 61, 80
BstDEI CTNAG 2 cut(s) 28, 50
BstKTI GATC 2 cut(s) 64, 83
BstMBI GATC 2 cut(s) 61, 80
DdeI CTNAG 2 cut(s) 28, 50
DpnI GATC 2 cut(s) 63, 82
DpnII GATC 2 cut(s) 61, 80
DraI TTTAAA 1 cut(s) 138
FaiI YATR 6 cut(s) 6, 41, 74, 76, 78, 131
FspBI CTAG 1 cut(s) 57
HinfI GANTC 1 cut(s) 52
Hpy188I TCNGA 2 cut(s) 31, 51
HpyCH4IV ACGT 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 107
HpyF3I CTNAG 2 cut(s) 28, 50
HpySE526I ACGT 1 cut(s) 37
Kzo9I GATC 2 cut(s) 61, 80
LmnI GCTCC 1 cut(s) 95
LpnPI CCDG 1 cut(s) 24
LweI GCATC 1 cut(s) 7
MaeI CTAG 1 cut(s) 57
MaeII ACGT 1 cut(s) 37
MalI GATC 2 cut(s) 63, 82
MboI GATC 2 cut(s) 61, 80
MboII GAAGA 1 cut(s) 44
MluCI AATT 1 cut(s) 85
MlyI GAGTC 1 cut(s) 61
MnlI CCTC 3 cut(s) 37, 134, 148
MseI TTAA 1 cut(s) 137
NdeII GATC 2 cut(s) 61, 80
PleI GAGTC 1 cut(s) 60
PpsI GAGTC 1 cut(s) 60
SaqAI TTAA 1 cut(s) 137
Sau3AI GATC 2 cut(s) 61, 80
SchI GAGTC 1 cut(s) 61
SetI ASST 4 cut(s) 29, 40, 126, 159
SfaNI GCATC 1 cut(s) 7
SgeI CNNG 3 cut(s) 23, 69, 137
Sse9I AATT 1 cut(s) 85
SspMI CTAG 1 cut(s) 57
TaiI ACGT 1 cut(s) 40
TaqI TCGA 1 cut(s) 126
TasI AATT 1 cut(s) 85
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TspDTI ATGAA 1 cut(s) 21
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.