RchiOBHm_Chr6g0260381

Family of unknown function (DUF716)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
15381021 .. 15381245
225 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23351

Sequence Viewer

Length: 225 bp
ATGGGCACGTTCATTGGGCAGATAGTACCTGGCTTTGCCCTCACACTTCTTGGTTTATGGCACACTGTCAACACTATCCGATCTTATTTTCTCAAAGGCCCTAGTAACTTTGGAGCAAGGTTTTGGTACCCATTGAACTGCCCTTTTTCCAAAATTAAACACTTGGAACTCATTTTCATCTTATCTTTCTCTGTATTGCAATTATTAAGACTTTCCTTTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.46

Weight (kDa)

10.18

Isoelectric Point (pI)

32.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 126
AccB1I GGYRCC 1 cut(s) 126
AfaI GTAC 2 cut(s) 27, 128
AgsI TTSAA 1 cut(s) 136
AjnI CCWGG 1 cut(s) 28
AoxI GGCC 1 cut(s) 97
Asp718I GGTACC 1 cut(s) 126
AspS9I GGNCC 1 cut(s) 98
BaeGI GKGCMC 1 cut(s) 8
BanI GGYRCC 1 cut(s) 126
BciT130I CCWGG 1 cut(s) 30
BfaI CTAG 1 cut(s) 102
Bme1390I CCNGG 1 cut(s) 30
BmgT120I GGNCC 1 cut(s) 98
BmiI GGNNCC 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 30
BseBI CCWGG 1 cut(s) 30
BseSI GKGCMC 1 cut(s) 8
BshFI GGCC 1 cut(s) 99
BshNI GGYRCC 1 cut(s) 126
BsnI GGCC 1 cut(s) 99
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 80
BspANI GGCC 1 cut(s) 99
BspLI GGNNCC 1 cut(s) 128
BspT107I GGYRCC 1 cut(s) 126
BssMI GATC 1 cut(s) 80
Bst2UI CCWGG 1 cut(s) 30
Bst4CI ACNGT 1 cut(s) 67
BstKTI GATC 1 cut(s) 83
BstMBI GATC 1 cut(s) 80
BstNI CCWGG 1 cut(s) 30
BstSCI CCNGG 1 cut(s) 28
BstSLI GKGCMC 1 cut(s) 8
BsuRI GGCC 1 cut(s) 99
BtsIMutI CAGTG 1 cut(s) 63
Cfr13I GGNCC 1 cut(s) 98
Csp6I GTAC 2 cut(s) 26, 127
CviJI RGCY 2 cut(s) 33, 99
CviKI_1 RGCY 2 cut(s) 33, 99
CviQI GTAC 2 cut(s) 26, 127
DpnI GATC 1 cut(s) 82
DpnII GATC 1 cut(s) 80
EcoO109I RGGNCCY 1 cut(s) 98
EcoRII CCWGG 1 cut(s) 28
FaiI YATR 1 cut(s) 58
FspBI CTAG 1 cut(s) 102
HaeIII GGCC 1 cut(s) 99
HincII GTYRAC 1 cut(s) 70
HindII GTYRAC 1 cut(s) 70
Hpy166II GTNNAC 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 70
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4IV ACGT 1 cut(s) 8
HpyCH4V TGCA 1 cut(s) 199
HpySE526I ACGT 1 cut(s) 8
KpnI GGTACC 1 cut(s) 130
Kzo9I GATC 1 cut(s) 80
LmnI GCTCC 1 cut(s) 113
LpnPI CCDG 2 cut(s) 15, 42
MaeI CTAG 1 cut(s) 102
MaeII ACGT 1 cut(s) 8
MaeIII GTNAC 1 cut(s) 104
MalI GATC 1 cut(s) 82
MboI GATC 1 cut(s) 80
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 2 cut(s) 153, 200
MnlI CCTC 1 cut(s) 50
MseI TTAA 3 cut(s) 156, 206, 223
MspR9I CCNGG 1 cut(s) 30
MvaI CCWGG 1 cut(s) 30
NdeII GATC 1 cut(s) 80
NlaIV GGNNCC 1 cut(s) 128
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
PspN4I GGNNCC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 98
RsaI GTAC 2 cut(s) 27, 128
RsaNI GTAC 2 cut(s) 26, 127
SaqAI TTAA 3 cut(s) 156, 206, 223
Sau3AI GATC 1 cut(s) 80
Sau96I GGNCC 1 cut(s) 98
ScrFI CCNGG 1 cut(s) 30
SduI GDGCHC 1 cut(s) 8
SetI ASST 3 cut(s) 11, 31, 122
SgeI CNNG 7 cut(s) 19, 41, 42, 62, 114, 129, 175
Sse9I AATT 2 cut(s) 153, 200
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 28
TaaI ACNGT 1 cut(s) 67
TaiI ACGT 1 cut(s) 11
TasI AATT 2 cut(s) 153, 200
Tru1I TTAA 3 cut(s) 156, 206, 223
Tru9I TTAA 3 cut(s) 156, 206, 223
TscAI CASTG 1 cut(s) 70
TspDTI ATGAA 1 cut(s) 166
TspRI CASTG 1 cut(s) 70
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.