Rmu_sc0000588.1_g000055

Family of unknown function (DUF716)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000588.1
Physical Location & Seq
Reverse (-)
229366 .. 229737
372 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000588.1_g000055.1.cds

Sequence Viewer

Length: 372 bp
atgttcttccgccttgccatattggcagggtttacgctttcagccgagtttattaattcgtttcaaatcctatctggggtcgttggattgcttatggcctctgttttctgccaagagcttttccttctccatttccactccactgaccatgttggtcttgaagggcattaccattggttattgcagctcatactgtttgcttctgtcatggcagctttagcagcaacttgttgccaaaccagtcttcctgcagcacttgttctgtctattttagttgtattccaaggttgctgttttatgaacatgggattcatgctttgggttcctaagtttgttcctaagggcattaccattggttattgcagctcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

13.52

Weight (kDa)

6.47

Isoelectric Point (pI)

31.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 10
AfiI CCNNNNNNNGG 1 cut(s) 76
AgsI TTSAA 2 cut(s) 65, 161
AjuI GAANNNNNNNTTGG 2 cut(s) 228, 260
AluBI AGCT 4 cut(s) 118, 187, 215, 366
AluI AGCT 4 cut(s) 118, 187, 215, 366
AoxI GGCC 1 cut(s) 96
ApeKI GCWGC 5 cut(s) 184, 212, 221, 251, 363
AseI ATTAAT 1 cut(s) 54
AxyI CCTNAGG 1 cut(s) 339
BbsI GAAGAC 1 cut(s) 236
BbvI GCAGC 4 cut(s) 196, 224, 233, 263
BfmI CTRYAG 1 cut(s) 249
BglI GCCNNNNNGGC 1 cut(s) 23
BisI GCNGC 5 cut(s) 185, 213, 222, 252, 364
BlsI GCNGC 5 cut(s) 186, 214, 223, 253, 365
BmiI GGNNCC 1 cut(s) 324
BpiI GAAGAC 1 cut(s) 236
BsaJI CCNNGG 1 cut(s) 283
Bsc4I CCNNNNNNNGG 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 240
Bse21I CCTNAGG 1 cut(s) 339
BseDI CCNNGG 1 cut(s) 283
BseLI CCNNNNNNNGG 1 cut(s) 76
BseNI ACTGG 1 cut(s) 240
BseXI GCAGC 4 cut(s) 196, 224, 233, 263
BshFI GGCC 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 76
BsnI GGCC 1 cut(s) 98
BspACI CCGC 1 cut(s) 10
BspANI GGCC 1 cut(s) 98
BspLI GGNNCC 1 cut(s) 324
BspMAI CTGCAG 1 cut(s) 253
BsrI ACTGG 1 cut(s) 240
BssECI CCNNGG 1 cut(s) 283
BssT1I CCWWGG 1 cut(s) 283
Bst4CI ACNGT 1 cut(s) 195
BstDEI CTNAG 2 cut(s) 327, 339
BstMWI GCNNNNNNNGC 3 cut(s) 23, 218, 221
BstSFI CTRYAG 1 cut(s) 249
BstV1I GCAGC 4 cut(s) 196, 224, 233, 263
BstV2I GAAGAC 1 cut(s) 236
Bsu36I CCTNAGG 1 cut(s) 339
BsuRI GGCC 1 cut(s) 98
BtsIMutI CAGTG 1 cut(s) 141
CviAII CATG 4 cut(s) 149, 208, 304, 313
CviJI RGCY 6 cut(s) 44, 98, 118, 187, 215, 366
CviKI_1 RGCY 6 cut(s) 44, 98, 118, 187, 215, 366
DdeI CTNAG 2 cut(s) 327, 339
Eco130I CCWWGG 1 cut(s) 283
Eco81I CCTNAGG 1 cut(s) 339
EcoT14I CCWWGG 1 cut(s) 283
ErhI CCWWGG 1 cut(s) 283
FaeI CATG 4 cut(s) 152, 211, 307, 316
FaiI YATR 9 cut(s) 20, 95, 150, 191, 209, 299, 305, 314, 370
FatI CATG 4 cut(s) 148, 207, 303, 312
Fnu4HI GCNGC 5 cut(s) 185, 213, 222, 252, 364
Fsp4HI GCNGC 5 cut(s) 185, 213, 222, 252, 364
GluI GCNGC 5 cut(s) 185, 213, 222, 252, 364
HaeIII GGCC 1 cut(s) 98
Hin1II CATG 4 cut(s) 152, 211, 307, 316
HinfI GANTC 1 cut(s) 309
Hpy166II GTNNAC 1 cut(s) 33
Hpy188III TCNNGA 1 cut(s) 158
Hpy8I GTNNAC 1 cut(s) 33
HpyAV CCTTC 2 cut(s) 134, 155
HpyCH4III ACNGT 1 cut(s) 195
HpyCH4V TGCA 3 cut(s) 184, 251, 363
HpyF10VI GCNNNNNNNGC 3 cut(s) 23, 218, 221
HpyF3I CTNAG 2 cut(s) 327, 339
Hsp92II CATG 4 cut(s) 152, 211, 307, 316
LpnPI CCDG 4 cut(s) 12, 60, 253, 261
Lsp1109I GCAGC 4 cut(s) 196, 224, 233, 263
MboII GAAGA 1 cut(s) 236
MluCI AATT 1 cut(s) 55
MmeI TCCRAC 1 cut(s) 64
MnlI CCTC 1 cut(s) 109
MseI TTAA 1 cut(s) 54
MwoI GCNNNNNNNGC 3 cut(s) 23, 218, 221
NlaIII CATG 4 cut(s) 152, 211, 307, 316
NlaIV GGNNCC 1 cut(s) 324
NmeAIII GCCGAG 1 cut(s) 70
PfeI GAWTC 1 cut(s) 309
PkrI GCNGC 5 cut(s) 186, 214, 223, 253, 365
PshBI ATTAAT 1 cut(s) 54
PspN4I GGNNCC 1 cut(s) 324
PstI CTGCAG 1 cut(s) 253
SaqAI TTAA 1 cut(s) 54
SatI GCNGC 5 cut(s) 185, 213, 222, 252, 364
SetI ASST 5 cut(s) 120, 189, 217, 289, 368
SfcI CTRYAG 1 cut(s) 249
Sse9I AATT 1 cut(s) 55
SsiI CCGC 1 cut(s) 10
StyI CCWWGG 1 cut(s) 283
TaaI ACNGT 1 cut(s) 195
TasI AATT 1 cut(s) 55
TfiI GAWTC 1 cut(s) 309
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 1 cut(s) 148
TseI GCWGC 5 cut(s) 184, 212, 221, 251, 363
TspDTI ATGAA 2 cut(s) 301, 314
TspRI CASTG 1 cut(s) 148
VspI ATTAAT 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.