RchiOBHm_Chr6g0260551

Family of unknown function (DUF716)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0001745
Physical Location & Seq
Forward (+)
15531490 .. 15531696
207 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23366

Sequence Viewer

Length: 207 bp
ATGGGCACGTTCATTGGGCACATAGTCCCTGGCTTTCCCCTCACTCTTCTTGGTTTATGGCACACTGTCAACACTATCCGATCTTATTTTCTCAAAGGCCCTAGTAACTTTGGAGCAAGGTTTTGGTACCCATCGAACTGCCCCTTTTCCAAAATTAAACACTTGGAACTCATTTTCATCTTATCTTTCTGTATTTGCAATTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF716

Protein Analysis

68

Amino Acids

7.83

Weight (kDa)

9.3

Isoelectric Point (pI)

39.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 126
AccB1I GGYRCC 1 cut(s) 126
AfaI GTAC 1 cut(s) 128
AjnI CCWGG 1 cut(s) 28
AoxI GGCC 1 cut(s) 97
Asp718I GGTACC 1 cut(s) 126
AspS9I GGNCC 1 cut(s) 98
BaeGI GKGCMC 2 cut(s) 8, 21
BanI GGYRCC 1 cut(s) 126
BccI CCATC 1 cut(s) 139
BciT130I CCWGG 1 cut(s) 30
BfaI CTAG 1 cut(s) 102
Bme1390I CCNGG 1 cut(s) 30
BmgT120I GGNCC 1 cut(s) 98
BmiI GGNNCC 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 28
BseBI CCWGG 1 cut(s) 30
BseDI CCNNGG 1 cut(s) 28
BseSI GKGCMC 2 cut(s) 8, 21
BshFI GGCC 1 cut(s) 99
BshNI GGYRCC 1 cut(s) 126
BslFI GGGAC 1 cut(s) 11
BsmFI GGGAC 1 cut(s) 11
BsnI GGCC 1 cut(s) 99
Bsp1286I GDGCHC 2 cut(s) 8, 21
Bsp143I GATC 1 cut(s) 80
BspANI GGCC 1 cut(s) 99
BspLI GGNNCC 1 cut(s) 128
BspT107I GGYRCC 1 cut(s) 126
BssECI CCNNGG 1 cut(s) 28
BssMI GATC 1 cut(s) 80
Bst2UI CCWGG 1 cut(s) 30
Bst4CI ACNGT 1 cut(s) 67
Bst6I CTCTTC 1 cut(s) 51
BstKTI GATC 1 cut(s) 83
BstMBI GATC 1 cut(s) 80
BstNI CCWGG 1 cut(s) 30
BstSCI CCNGG 1 cut(s) 28
BstSLI GKGCMC 2 cut(s) 8, 21
BsuRI GGCC 1 cut(s) 99
BtsIMutI CAGTG 1 cut(s) 63
Cfr13I GGNCC 1 cut(s) 98
Csp6I GTAC 1 cut(s) 127
CviJI RGCY 2 cut(s) 33, 99
CviKI_1 RGCY 2 cut(s) 33, 99
CviQI GTAC 1 cut(s) 127
DpnI GATC 1 cut(s) 82
DpnII GATC 1 cut(s) 80
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
EcoO109I RGGNCCY 1 cut(s) 98
EcoRII CCWGG 1 cut(s) 28
FaiI YATR 2 cut(s) 23, 58
FaqI GGGAC 1 cut(s) 11
FspBI CTAG 1 cut(s) 102
HaeIII GGCC 1 cut(s) 99
HincII GTYRAC 1 cut(s) 70
HindII GTYRAC 1 cut(s) 70
Hpy166II GTNNAC 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 70
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4IV ACGT 1 cut(s) 8
HpyCH4V TGCA 1 cut(s) 198
HpySE526I ACGT 1 cut(s) 8
KpnI GGTACC 1 cut(s) 130
Kzo9I GATC 1 cut(s) 80
LmnI GCTCC 1 cut(s) 113
LpnPI CCDG 2 cut(s) 15, 42
MaeI CTAG 1 cut(s) 102
MaeII ACGT 1 cut(s) 8
MaeIII GTNAC 1 cut(s) 104
MalI GATC 1 cut(s) 82
MboI GATC 1 cut(s) 80
MboII GAAGA 1 cut(s) 38
MhlI GDGCHC 2 cut(s) 8, 21
MluCI AATT 2 cut(s) 153, 199
MnlI CCTC 1 cut(s) 50
MseI TTAA 2 cut(s) 156, 205
MspR9I CCNGG 1 cut(s) 30
MvaI CCWGG 1 cut(s) 30
NdeII GATC 1 cut(s) 80
NlaIV GGNNCC 1 cut(s) 128
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
PspN4I GGNNCC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 98
RsaI GTAC 1 cut(s) 128
RsaNI GTAC 1 cut(s) 127
SaqAI TTAA 2 cut(s) 156, 205
Sau3AI GATC 1 cut(s) 80
Sau96I GGNCC 1 cut(s) 98
ScrFI CCNGG 1 cut(s) 30
SduI GDGCHC 2 cut(s) 8, 21
SetI ASST 2 cut(s) 11, 122
SgeI CNNG 7 cut(s) 19, 41, 42, 62, 114, 129, 175
Sse9I AATT 2 cut(s) 153, 199
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 28
TaaI ACNGT 1 cut(s) 67
TaiI ACGT 1 cut(s) 11
TaqI TCGA 1 cut(s) 134
TasI AATT 2 cut(s) 153, 199
Tru1I TTAA 2 cut(s) 156, 205
Tru9I TTAA 2 cut(s) 156, 205
TscAI CASTG 1 cut(s) 70
TspDTI ATGAA 1 cut(s) 166
TspRI CASTG 1 cut(s) 70
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.