RchiOBHm_Chr6g0261501

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0001171
Physical Location & Seq
Reverse (-)
16360957 .. 16363252
2296 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23453

Sequence Viewer

Length: 156 bp
ATGTGTTTAAGCTTGAATGATGAAATCAATGTCCAATTCATGGTGTTAATTGAACCACGAGAGTTCTATTTTGAGGTCGAAGACGGCTTGGATCAGAGGAATGTCTCGGCTCAGTTGCTGCGCCTCTTTTTCCATGACTGCTTCATTGAGGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

6.14

Weight (kDa)

4.14

Isoelectric Point (pI)

55.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 40
AclWI GGATC 1 cut(s) 99
AfiI CCNNNNNNNGG 1 cut(s) 40
AgsI TTSAA 2 cut(s) 16, 53
AluBI AGCT 1 cut(s) 12
AluI AGCT 1 cut(s) 12
Alw26I GTCTC 1 cut(s) 109
AlwI GGATC 1 cut(s) 99
AlwNI CAGNNNCTG 1 cut(s) 118
ApeKI GCWGC 1 cut(s) 118
AspLEI GCGC 1 cut(s) 123
BauI CACGAG 1 cut(s) 57
BbsI GAAGAC 1 cut(s) 87
BbvI GCAGC 1 cut(s) 105
BceAI ACGGC 1 cut(s) 100
BcoDI GTCTC 1 cut(s) 109
BisI GCNGC 1 cut(s) 119
BlsI GCNGC 1 cut(s) 120
BpiI GAAGAC 1 cut(s) 87
Bsc4I CCNNNNNNNGG 1 cut(s) 40
BseLI CCNNNNNNNGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 125
BseXI GCAGC 1 cut(s) 105
BslI CCNNNNNNNGG 1 cut(s) 40
BsmAI GTCTC 1 cut(s) 109
Bsp143I GATC 1 cut(s) 91
BspCNI CTCAG 1 cut(s) 124
BspPI GGATC 1 cut(s) 99
BssMI GATC 1 cut(s) 91
BssSI CACGAG 1 cut(s) 57
Bst2BI CACGAG 1 cut(s) 57
BstDEI CTNAG 1 cut(s) 111
BstHHI GCGC 1 cut(s) 123
BstKTI GATC 1 cut(s) 94
BstMAI GTCTC 1 cut(s) 109
BstMBI GATC 1 cut(s) 91
BstV1I GCAGC 1 cut(s) 105
BstV2I GAAGAC 1 cut(s) 87
CaiI CAGNNNCTG 1 cut(s) 118
CfoI GCGC 1 cut(s) 123
CviAII CATG 2 cut(s) 40, 134
CviJI RGCY 3 cut(s) 12, 87, 110
CviKI_1 RGCY 3 cut(s) 12, 87, 110
DdeI CTNAG 1 cut(s) 111
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
FaeI CATG 2 cut(s) 43, 137
FaiI YATR 2 cut(s) 41, 135
FatI CATG 2 cut(s) 39, 133
Fnu4HI GCNGC 1 cut(s) 119
Fsp4HI GCNGC 1 cut(s) 119
GlaI GCGC 1 cut(s) 122
GluI GCNGC 1 cut(s) 119
HhaI GCGC 1 cut(s) 123
Hin1II CATG 2 cut(s) 43, 137
Hin6I GCGC 1 cut(s) 121
HinP1I GCGC 1 cut(s) 121
HindIII AAGCTT 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 96
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 2 cut(s) 43, 137
HspAI GCGC 1 cut(s) 121
Kzo9I GATC 1 cut(s) 91
Lsp1109I GCAGC 1 cut(s) 105
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MboII GAAGA 1 cut(s) 92
MluCI AATT 2 cut(s) 35, 48
MnlI CCTC 4 cut(s) 67, 90, 134, 142
MseI TTAA 2 cut(s) 8, 47
NdeII GATC 1 cut(s) 91
NlaIII CATG 2 cut(s) 43, 137
NmeAIII GCCGAG 1 cut(s) 86
PflMI CCANNNNNTGG 1 cut(s) 40
PkrI GCNGC 1 cut(s) 120
PstNI CAGNNNCTG 1 cut(s) 118
SaqAI TTAA 2 cut(s) 8, 47
SatI GCNGC 1 cut(s) 119
Sau3AI GATC 1 cut(s) 91
SetI ASST 2 cut(s) 14, 78
SgeI CNNG 7 cut(s) 25, 52, 69, 71, 100, 118, 146
Sse9I AATT 2 cut(s) 35, 48
TaqI TCGA 1 cut(s) 78
TasI AATT 2 cut(s) 35, 48
Tru1I TTAA 2 cut(s) 8, 47
Tru9I TTAA 2 cut(s) 8, 47
TseI GCWGC 1 cut(s) 118
TspDTI ATGAA 3 cut(s) 28, 36, 133
Van91I CCANNNNNTGG 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.