RchiOBHm_Chr6g0267301

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
23958483 .. 23963285
4803 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23976

Sequence Viewer

Length: 246 bp
ATGATTAGGTTTCTTGGAAACAATAAGTTGAATGGCGCTCTCTCTGAATCAAAAAGCTCATCTCTTCTCAATGTAGATTTATCATACAATAATCTAGTTGGGAGCATTCCTTCTTGGGTCAACGGAACGAGTTTACAGCTTAGTTTAGTTGCCAACAACTTCACCCTTGACAGTTCAAACAGCAGGAAGCTGTCAAGGGACAATTATGGAGATTACGTGATCCCCAGGGGAAGCCACCAGGTGTAA

Protein Analysis

81

Amino Acids

8.85

Weight (kDa)

9.3

Isoelectric Point (pI)

18.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 214
AdeI CACNNNGTG 1 cut(s) 241
AgsI TTSAA 2 cut(s) 31, 177
AjnI CCWGG 2 cut(s) 224, 237
AluBI AGCT 3 cut(s) 57, 139, 190
AluI AGCT 3 cut(s) 57, 139, 190
AlwI GGATC 1 cut(s) 214
AspLEI GCGC 1 cut(s) 38
AsuHPI GGTGA 1 cut(s) 154
BciT130I CCWGG 2 cut(s) 226, 239
BfaI CTAG 1 cut(s) 95
BfoI RGCGCY 1 cut(s) 39
Bme1390I CCNGG 2 cut(s) 226, 239
BmrFI CCNGG 2 cut(s) 226, 239
BsaAI YACGTR 1 cut(s) 217
BsaJI CCNNGG 2 cut(s) 224, 225
BsaXI ACNNNNNCTCC 2 cut(s) 201, 231
BseBI CCWGG 2 cut(s) 226, 239
BseDI CCNNGG 2 cut(s) 224, 225
BslFI GGGAC 1 cut(s) 212
BsmFI GGGAC 1 cut(s) 212
BsmI GAATGC 1 cut(s) 105
Bsp143I GATC 1 cut(s) 219
BspPI GGATC 1 cut(s) 214
BssECI CCNNGG 2 cut(s) 224, 225
BssMI GATC 1 cut(s) 219
Bst2UI CCWGG 2 cut(s) 226, 239
Bst4CI ACNGT 1 cut(s) 173
Bst6I CTCTTC 1 cut(s) 69
BstBAI YACGTR 1 cut(s) 217
BstDEI CTNAG 1 cut(s) 140
BstH2I RGCGCY 1 cut(s) 39
BstHHI GCGC 1 cut(s) 38
BstKTI GATC 1 cut(s) 222
BstMBI GATC 1 cut(s) 219
BstNI CCWGG 2 cut(s) 226, 239
BstSCI CCNGG 2 cut(s) 224, 237
CfoI GCGC 1 cut(s) 38
CsiI ACCWGGT 1 cut(s) 237
CviJI RGCY 4 cut(s) 57, 139, 190, 234
CviKI_1 RGCY 4 cut(s) 57, 139, 190, 234
DdeI CTNAG 1 cut(s) 140
DpnI GATC 1 cut(s) 221
DpnII GATC 1 cut(s) 219
DraIII CACNNNGTG 1 cut(s) 241
Eam1104I CTCTTC 1 cut(s) 69
EarI CTCTTC 1 cut(s) 69
EcoRII CCWGG 2 cut(s) 224, 237
FaiI YATR 2 cut(s) 85, 207
FaqI GGGAC 1 cut(s) 212
FspBI CTAG 1 cut(s) 95
GlaI GCGC 1 cut(s) 37
HaeII RGCGCY 1 cut(s) 39
HhaI GCGC 1 cut(s) 38
Hin6I GCGC 1 cut(s) 36
HinP1I GCGC 1 cut(s) 36
HincII GTYRAC 1 cut(s) 121
HindII GTYRAC 1 cut(s) 121
HinfI GANTC 1 cut(s) 47
HphI GGTGA 1 cut(s) 154
Hpy166II GTNNAC 2 cut(s) 121, 134
Hpy188I TCNGA 1 cut(s) 46
Hpy8I GTNNAC 2 cut(s) 121, 134
HpyAV CCTTC 1 cut(s) 120
HpyCH4III ACNGT 1 cut(s) 173
HpyCH4IV ACGT 1 cut(s) 216
HpyF3I CTNAG 1 cut(s) 140
HpySE526I ACGT 1 cut(s) 216
HspAI GCGC 1 cut(s) 36
Kzo9I GATC 1 cut(s) 219
LmnI GCTCC 1 cut(s) 102
LpnPI CCDG 4 cut(s) 169, 211, 224, 238
MabI ACCWGGT 1 cut(s) 237
MaeI CTAG 1 cut(s) 95
MaeII ACGT 1 cut(s) 216
MalI GATC 1 cut(s) 221
MboI GATC 1 cut(s) 219
MboII GAAGA 1 cut(s) 56
MluCI AATT 1 cut(s) 202
MspR9I CCNGG 2 cut(s) 226, 239
Mva1269I GAATGC 1 cut(s) 105
MvaI CCWGG 2 cut(s) 226, 239
NdeII GATC 1 cut(s) 219
PasI CCCWGGG 1 cut(s) 225
PctI GAATGC 1 cut(s) 105
PfeI GAWTC 1 cut(s) 47
Ppu21I YACGTR 1 cut(s) 217
Psp6I CCWGG 2 cut(s) 224, 237
PspGI CCWGG 2 cut(s) 224, 237
Sau3AI GATC 1 cut(s) 219
ScrFI CCNGG 2 cut(s) 226, 239
SetI ASST 6 cut(s) 11, 59, 141, 192, 219, 243
SexAI ACCWGGT 1 cut(s) 237
Sse9I AATT 1 cut(s) 202
SspMI CTAG 1 cut(s) 95
StyD4I CCNGG 2 cut(s) 224, 237
TaaI ACNGT 1 cut(s) 173
TaiI ACGT 1 cut(s) 219
TasI AATT 1 cut(s) 202
TfiI GAWTC 1 cut(s) 47
TspGWI ACGGA 1 cut(s) 138
XspI CTAG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.