Rh6DG122300

Belongs to the thiolase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
17170510 .. 17178841
8332 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG122300.1

Sequence Viewer

Length: 237 bp
ATGTATCACAATGCAGGCATTGGTACTCTTTTGGAAAACTGTAATGATCTCAAAACATGTCAAGACCAGGGACGTAATATTGTGGACCCAAAAACTGGAGAGGAGAGGCATGTTAGAATTTATGTGGATGATGACATCCGGCCAAATGCAAACATGACTGATTTGGCGAAATTGAAGCCTGCATTTAAATCAGATGGGACAACAACTGCAGGAAATGCTAGCCAGCAATCCACTTAA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.57

Weight (kDa)

5.5

Isoelectric Point (pI)

30.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Thiolase_N PF00108 34 - 75 1.9e-09 Thiolase, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 95
AcoI YGGCCR 1 cut(s) 140
AcsI RAATTY 1 cut(s) 117
AfaI GTAC 1 cut(s) 25
AfiI CCNNNNNNNGG 1 cut(s) 95
AflIII ACRYGT 1 cut(s) 56
AgsI TTSAA 1 cut(s) 175
AjnI CCWGG 1 cut(s) 66
AoxI GGCC 1 cut(s) 140
ApoI RAATTY 1 cut(s) 117
AspS9I GGNCC 1 cut(s) 85
AsuNHI GCTAGC 1 cut(s) 218
AvaII GGWCC 1 cut(s) 85
BccI CCATC 1 cut(s) 188
BciT130I CCWGG 1 cut(s) 68
BfaI CTAG 1 cut(s) 219
BfmI CTRYAG 1 cut(s) 207
Bme1390I CCNGG 1 cut(s) 68
Bme18I GGWCC 1 cut(s) 85
BmgT120I GGNCC 1 cut(s) 85
BmiI GGNNCC 1 cut(s) 87
BmrFI CCNGG 1 cut(s) 68
BmtI GCTAGC 1 cut(s) 222
BpmI CTGGAG 1 cut(s) 117
BsaJI CCNNGG 1 cut(s) 67
Bsc4I CCNNNNNNNGG 1 cut(s) 95
Bse1I ACTGG 1 cut(s) 100
BseBI CCWGG 1 cut(s) 68
BseDI CCNNGG 1 cut(s) 67
BseGI GGATG 2 cut(s) 133, 135
BseLI CCNNNNNNNGG 1 cut(s) 95
BseNI ACTGG 1 cut(s) 100
BseRI GAGGAG 1 cut(s) 116
BshFI GGCC 1 cut(s) 142
BsiSI CCGG 1 cut(s) 139
BslFI GGGAC 2 cut(s) 84, 211
BslI CCNNNNNNNGG 1 cut(s) 95
BsmFI GGGAC 2 cut(s) 84, 211
BsnI GGCC 1 cut(s) 142
Bsp143I GATC 1 cut(s) 46
BspANI GGCC 1 cut(s) 142
BspLI GGNNCC 1 cut(s) 87
BspMAI CTGCAG 1 cut(s) 211
BspOI GCTAGC 1 cut(s) 222
BsrI ACTGG 1 cut(s) 100
BssECI CCNNGG 1 cut(s) 67
BssMI GATC 1 cut(s) 46
Bst2UI CCWGG 1 cut(s) 68
Bst4CI ACNGT 1 cut(s) 41
BstAPI GCANNNNNTGC 1 cut(s) 215
BstC8I GCNNGC 4 cut(s) 16, 180, 220, 224
BstF5I GGATG 2 cut(s) 133, 135
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstMWI GCNNNNNNNGC 1 cut(s) 215
BstNI CCWGG 1 cut(s) 68
BstNSI RCATGY 2 cut(s) 60, 113
BstSCI CCNGG 1 cut(s) 66
BstSFI CTRYAG 1 cut(s) 207
BsuRI GGCC 1 cut(s) 142
BtsCI GGATG 2 cut(s) 133, 135
Cac8I GCNNGC 4 cut(s) 16, 180, 220, 224
Cfr13I GGNCC 1 cut(s) 85
Csp6I GTAC 1 cut(s) 24
CviAII CATG 3 cut(s) 57, 110, 154
CviJI RGCY 3 cut(s) 142, 178, 222
CviKI_1 RGCY 3 cut(s) 142, 178, 222
CviQI GTAC 1 cut(s) 24
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
DraI TTTAAA 1 cut(s) 187
EaeI YGGCCR 1 cut(s) 140
Eco47I GGWCC 1 cut(s) 85
EcoRII CCWGG 1 cut(s) 66
FaeI CATG 3 cut(s) 60, 113, 157
FaiI YATR 4 cut(s) 58, 111, 123, 155
FaqI GGGAC 2 cut(s) 84, 211
FatI CATG 3 cut(s) 56, 109, 153
FokI GGATG 2 cut(s) 122, 140
FspBI CTAG 1 cut(s) 219
GsuI CTGGAG 1 cut(s) 117
HaeIII GGCC 1 cut(s) 142
HapII CCGG 1 cut(s) 139
Hin1II CATG 3 cut(s) 60, 113, 157
HpaII CCGG 1 cut(s) 139
Hpy166II GTNNAC 1 cut(s) 85
Hpy188I TCNGA 1 cut(s) 193
Hpy188III TCNNGA 1 cut(s) 62
Hpy8I GTNNAC 1 cut(s) 85
HpyCH4III ACNGT 1 cut(s) 41
HpyCH4IV ACGT 1 cut(s) 73
HpyCH4V TGCA 4 cut(s) 14, 149, 182, 209
HpyF10VI GCNNNNNNNGC 1 cut(s) 215
HpySE526I ACGT 1 cut(s) 73
Hsp92II CATG 3 cut(s) 60, 113, 157
Kzo9I GATC 1 cut(s) 46
LpnPI CCDG 6 cut(s) 53, 80, 81, 152, 192, 195
MaeI CTAG 1 cut(s) 219
MaeII ACGT 1 cut(s) 73
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MluCI AATT 2 cut(s) 117, 170
MnlI CCTC 2 cut(s) 94, 99
MseI TTAA 2 cut(s) 186, 235
MspI CCGG 1 cut(s) 139
MspR9I CCNGG 1 cut(s) 68
MvaI CCWGG 1 cut(s) 68
MwoI GCNNNNNNNGC 1 cut(s) 215
NdeII GATC 1 cut(s) 46
NheI GCTAGC 1 cut(s) 218
NlaIII CATG 3 cut(s) 60, 113, 157
NlaIV GGNNCC 1 cut(s) 87
NspI RCATGY 2 cut(s) 60, 113
PciI ACATGT 1 cut(s) 56
PflMI CCANNNNNTGG 1 cut(s) 95
PscI ACATGT 1 cut(s) 56
Psp6I CCWGG 1 cut(s) 66
PspGI CCWGG 1 cut(s) 66
PspN4I GGNNCC 1 cut(s) 87
PspPI GGNCC 1 cut(s) 85
PstI CTGCAG 1 cut(s) 211
RsaI GTAC 1 cut(s) 25
RsaNI GTAC 1 cut(s) 24
SaqAI TTAA 2 cut(s) 186, 235
Sau3AI GATC 1 cut(s) 46
Sau96I GGNCC 1 cut(s) 85
ScrFI CCNGG 1 cut(s) 68
SetI ASST 1 cut(s) 76
SfcI CTRYAG 1 cut(s) 207
SinI GGWCC 1 cut(s) 85
SmiI ATTTAAAT 1 cut(s) 187
Sse9I AATT 2 cut(s) 117, 170
SspI AATATT 1 cut(s) 79
SspMI CTAG 1 cut(s) 219
StyD4I CCNGG 1 cut(s) 66
SwaI ATTTAAAT 1 cut(s) 187
TaaI ACNGT 1 cut(s) 41
TaiI ACGT 1 cut(s) 76
TasI AATT 2 cut(s) 117, 170
Tru1I TTAA 2 cut(s) 186, 235
Tru9I TTAA 2 cut(s) 186, 235
Van91I CCANNNNNTGG 1 cut(s) 95
VpaK11BI GGWCC 1 cut(s) 85
XapI RAATTY 1 cut(s) 117
XceI RCATGY 2 cut(s) 60, 113
XspI CTAG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.