RchiOBHm_Chr6g0277651

Belongs to the thiolase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
40160920 .. 40161223
304 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24908

Sequence Viewer

Length: 153 bp
ATGACTGATTTGGCGAAATTGAAGCTTGCATTTAAATCAGATGGGACAACAACTGCAGTACTCCTGATGAAGAGAAGTGTAGCTATTCAGAAGGGACTTCCTATTATTGGTGTTTTCAGGTATGACATTGTAGTTTTATTAAACAATTGCTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.48

Weight (kDa)

9.74

Isoelectric Point (pI)

17.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 60
AfiI CCNNNNNNNGG 1 cut(s) 107
AgsI TTSAA 1 cut(s) 22
AluBI AGCT 2 cut(s) 25, 83
AluI AGCT 2 cut(s) 25, 83
BccI CCATC 1 cut(s) 35
BfmI CTRYAG 1 cut(s) 54
BmcAI AGTACT 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 107
BseLI CCNNNNNNNGG 1 cut(s) 107
BslFI GGGAC 2 cut(s) 58, 108
BslI CCNNNNNNNGG 1 cut(s) 107
BsmFI GGGAC 2 cut(s) 58, 108
BspMAI CTGCAG 1 cut(s) 58
Bst6I CTCTTC 1 cut(s) 65
BstC8I GCNNGC 1 cut(s) 27
BstSFI CTRYAG 1 cut(s) 54
Cac8I GCNNGC 1 cut(s) 27
Csp6I GTAC 1 cut(s) 59
CviJI RGCY 2 cut(s) 25, 83
CviKI_1 RGCY 2 cut(s) 25, 83
CviQI GTAC 1 cut(s) 59
DraI TTTAAA 1 cut(s) 34
Eam1104I CTCTTC 1 cut(s) 65
EarI CTCTTC 1 cut(s) 65
FaiI YATR 1 cut(s) 123
FaqI GGGAC 2 cut(s) 58, 108
FspEI CC 8 cut(s) 27, 28, 77, 77, 78, 93, 103, 114
HindIII AAGCTT 1 cut(s) 23
Hpy188I TCNGA 2 cut(s) 40, 90
Hpy188III TCNNGA 1 cut(s) 64
HpyAV CCTTC 1 cut(s) 85
HpyCH4V TGCA 2 cut(s) 29, 56
LpnPI CCDG 2 cut(s) 77, 103
MboII GAAGA 1 cut(s) 82
MfeI CAATTG 1 cut(s) 145
MluCI AATT 2 cut(s) 17, 145
MseI TTAA 2 cut(s) 33, 140
MunI CAATTG 1 cut(s) 145
PstI CTGCAG 1 cut(s) 58
RsaI GTAC 1 cut(s) 60
RsaNI GTAC 1 cut(s) 59
SaqAI TTAA 2 cut(s) 33, 140
ScaI AGTACT 1 cut(s) 60
SetI ASST 3 cut(s) 27, 85, 122
SfcI CTRYAG 1 cut(s) 54
SgeI CNNG 3 cut(s) 38, 76, 130
SmiI ATTTAAAT 1 cut(s) 34
Sse9I AATT 2 cut(s) 17, 145
SwaI ATTTAAAT 1 cut(s) 34
TasI AATT 2 cut(s) 17, 145
TatI WGTACW 1 cut(s) 58
Tru1I TTAA 2 cut(s) 33, 140
Tru9I TTAA 2 cut(s) 33, 140
TspDTI ATGAA 1 cut(s) 83
ZrmI AGTACT 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.