Rroxscaffold_1G00000350

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0001691
Physical Location & Seq
Reverse (-)
593576 .. 601684
8109 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00000350.1

Sequence Viewer

Length: 492 bp
ATGCAAATGGAGATAGGTACTCCAGCTGATCCCTTCCCAGCAAGGGACTTGATCTTCAACAATCTAATTGGACAAATACCAGACTCACTGTTTAATTTGAGTTCTCTTTCCATCCTGTTTCTTGGAAACAATAAGTTGAATGGCGCTCTCTCTGAATCGAAAAGCTCATCTCTTCTCAATGTAGATTTATCATACAATAATCTAGTTGGGAGCATTCCTTCTTGGGTCAATGGAACGAGTTTACAGCTTAATTTAGTTGCCAACAACTTCACCCTTGACAGTTCAAACAGCAGTTTTGACTCAGGCTCACACTGTCAATCCAATGATCTATTGGCCGTATCATCATATGGTTTCCCAGATCTATTAACATGTTATGTTTGTTTCTCCCCTATTTTGGTGATAATCATGCATGATTTTGTGTACGAAGCTGTCAAGGGACAATTATGGAGATTACGTGATCCCCAGGGGAAGCCACCAGGTGTAATACAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 Malectin Pkinase Pkinase_Tyr

Protein Analysis

163

Amino Acids

17.74

Weight (kDa)

4.51

Isoelectric Point (pI)

38.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 23, 452
AcoI YGGCCR 1 cut(s) 333
AdeI CACNNNGTG 1 cut(s) 479
AfaI GTAC 2 cut(s) 19, 422
AfiI CCNNNNNNNGG 2 cut(s) 43, 394
AflIII ACRYGT 1 cut(s) 368
AgsI TTSAA 3 cut(s) 58, 139, 285
AjnI CCWGG 2 cut(s) 462, 475
AluBI AGCT 4 cut(s) 26, 165, 247, 428
AluI AGCT 4 cut(s) 26, 165, 247, 428
AlwI GGATC 2 cut(s) 23, 452
AoxI GGCC 1 cut(s) 333
AspLEI GCGC 1 cut(s) 146
AsuHPI GGTGA 2 cut(s) 262, 409
BccI CCATC 1 cut(s) 119
BceAI ACGGC 1 cut(s) 320
BciT130I CCWGG 2 cut(s) 464, 477
BfaI CTAG 1 cut(s) 203
BfoI RGCGCY 1 cut(s) 147
BglII AGATCT 1 cut(s) 358
Bme1390I CCNGG 2 cut(s) 464, 477
BmrFI CCNGG 2 cut(s) 464, 477
BpmI CTGGAG 1 cut(s) 6
BsaAI YACGTR 1 cut(s) 455
BsaJI CCNNGG 2 cut(s) 462, 463
BsaXI ACNNNNNCTCC 2 cut(s) 439, 469
Bsc4I CCNNNNNNNGG 2 cut(s) 43, 394
BseBI CCWGG 2 cut(s) 464, 477
BseDI CCNNGG 2 cut(s) 462, 463
BseGI GGATG 1 cut(s) 111
BseLI CCNNNNNNNGG 2 cut(s) 43, 394
BseMII CTCAG 1 cut(s) 315
BseYI CCCAGC 1 cut(s) 37
BshFI GGCC 1 cut(s) 335
BslFI GGGAC 2 cut(s) 59, 450
BslI CCNNNNNNNGG 2 cut(s) 43, 394
BsmFI GGGAC 2 cut(s) 59, 450
BsmI GAATGC 1 cut(s) 213
BsnI GGCC 1 cut(s) 335
Bsp143I GATC 5 cut(s) 28, 51, 325, 358, 457
BspANI GGCC 1 cut(s) 335
BspCNI CTCAG 1 cut(s) 314
BspPI GGATC 2 cut(s) 23, 452
BssECI CCNNGG 2 cut(s) 462, 463
BssMI GATC 5 cut(s) 28, 51, 325, 358, 457
Bst2UI CCWGG 2 cut(s) 464, 477
Bst4CI ACNGT 3 cut(s) 90, 281, 314
Bst6I CTCTTC 1 cut(s) 177
BstBAI YACGTR 1 cut(s) 455
BstDEI CTNAG 1 cut(s) 301
BstF5I GGATG 1 cut(s) 111
BstH2I RGCGCY 1 cut(s) 147
BstHHI GCGC 1 cut(s) 146
BstKTI GATC 5 cut(s) 31, 54, 328, 361, 460
BstMBI GATC 5 cut(s) 28, 51, 325, 358, 457
BstNI CCWGG 2 cut(s) 464, 477
BstNSI RCATGY 1 cut(s) 372
BstSCI CCNGG 2 cut(s) 462, 475
BstX2I RGATCY 1 cut(s) 358
BstYI RGATCY 1 cut(s) 358
BsuRI GGCC 1 cut(s) 335
BtsCI GGATG 1 cut(s) 111
BtsIMutI CAGTG 2 cut(s) 86, 310
CfoI GCGC 1 cut(s) 146
CsiI ACCWGGT 1 cut(s) 475
Csp6I GTAC 2 cut(s) 18, 421
CviAII CATG 3 cut(s) 369, 406, 410
CviJI RGCY 7 cut(s) 26, 165, 247, 306, 335, 428, 472
CviKI_1 RGCY 7 cut(s) 26, 165, 247, 306, 335, 428, 472
CviQI GTAC 2 cut(s) 18, 421
DdeI CTNAG 1 cut(s) 301
DpnI GATC 5 cut(s) 30, 53, 327, 360, 459
DpnII GATC 5 cut(s) 28, 51, 325, 358, 457
DraIII CACNNNGTG 1 cut(s) 479
EaeI YGGCCR 1 cut(s) 333
Eam1104I CTCTTC 1 cut(s) 177
EarI CTCTTC 1 cut(s) 177
EcoRII CCWGG 2 cut(s) 462, 475
EcoT22I ATGCAT 1 cut(s) 411
FaeI CATG 3 cut(s) 372, 409, 413
FaiI YATR 8 cut(s) 193, 346, 348, 370, 375, 407, 411, 445
FaqI GGGAC 2 cut(s) 59, 450
FatI CATG 3 cut(s) 368, 405, 409
FauNDI CATATG 1 cut(s) 346
FokI GGATG 1 cut(s) 98
FspBI CTAG 1 cut(s) 203
GlaI GCGC 1 cut(s) 145
GsaI CCCAGC 1 cut(s) 41
GsuI CTGGAG 1 cut(s) 6
HaeII RGCGCY 1 cut(s) 147
HaeIII GGCC 1 cut(s) 335
HhaI GCGC 1 cut(s) 146
Hin1II CATG 3 cut(s) 372, 409, 413
Hin6I GCGC 1 cut(s) 144
HinP1I GCGC 1 cut(s) 144
HinfI GANTC 3 cut(s) 83, 155, 299
HphI GGTGA 2 cut(s) 262, 409
Hpy166II GTNNAC 2 cut(s) 242, 421
Hpy188I TCNGA 1 cut(s) 154
Hpy8I GTNNAC 2 cut(s) 242, 421
HpyAV CCTTC 2 cut(s) 43, 228
HpyCH4III ACNGT 3 cut(s) 90, 281, 314
HpyCH4IV ACGT 1 cut(s) 454
HpyCH4V TGCA 2 cut(s) 4, 409
HpyF3I CTNAG 1 cut(s) 301
HpySE526I ACGT 1 cut(s) 454
Hsp92II CATG 3 cut(s) 372, 409, 413
HspAI GCGC 1 cut(s) 144
Kzo9I GATC 5 cut(s) 28, 51, 325, 358, 457
LmnI GCTCC 1 cut(s) 210
LpnPI CCDG 9 cut(s) 36, 51, 93, 128, 288, 369, 449, 462, 476
MabI ACCWGGT 1 cut(s) 475
MaeI CTAG 1 cut(s) 203
MaeII ACGT 1 cut(s) 454
MalI GATC 5 cut(s) 30, 53, 327, 360, 459
MboI GATC 5 cut(s) 28, 51, 325, 358, 457
MboII GAAGA 2 cut(s) 46, 164
MflI RGATCY 1 cut(s) 358
MluCI AATT 4 cut(s) 66, 94, 250, 440
MlyI GAGTC 2 cut(s) 77, 293
Mph1103I ATGCAT 1 cut(s) 411
MseI TTAA 3 cut(s) 93, 249, 365
MspA1I CMGCKG 1 cut(s) 26
MspR9I CCNGG 2 cut(s) 464, 477
Mva1269I GAATGC 1 cut(s) 213
MvaI CCWGG 2 cut(s) 464, 477
NdeI CATATG 1 cut(s) 346
NdeII GATC 5 cut(s) 28, 51, 325, 358, 457
NlaIII CATG 3 cut(s) 372, 409, 413
NsiI ATGCAT 1 cut(s) 411
NspI RCATGY 1 cut(s) 372
PasI CCCWGGG 1 cut(s) 463
PciI ACATGT 1 cut(s) 368
PctI GAATGC 1 cut(s) 213
PfeI GAWTC 1 cut(s) 155
PleI GAGTC 2 cut(s) 77, 293
PpsI GAGTC 2 cut(s) 77, 293
Ppu21I YACGTR 1 cut(s) 455
PscI ACATGT 1 cut(s) 368
Psp6I CCWGG 2 cut(s) 462, 475
PspFI CCCAGC 1 cut(s) 37
PspGI CCWGG 2 cut(s) 462, 475
PsuI RGATCY 1 cut(s) 358
PvuII CAGCTG 1 cut(s) 26
RsaI GTAC 2 cut(s) 19, 422
RsaNI GTAC 2 cut(s) 18, 421
SaqAI TTAA 3 cut(s) 93, 249, 365
Sau3AI GATC 5 cut(s) 28, 51, 325, 358, 457
SchI GAGTC 2 cut(s) 77, 293
ScrFI CCNGG 2 cut(s) 464, 477
SetI ASST 7 cut(s) 19, 28, 167, 249, 430, 457, 481
SexAI ACCWGGT 1 cut(s) 475
Sse9I AATT 4 cut(s) 66, 94, 250, 440
SspMI CTAG 1 cut(s) 203
StyD4I CCNGG 2 cut(s) 462, 475
TaaI ACNGT 3 cut(s) 90, 281, 314
TaiI ACGT 1 cut(s) 457
TaqI TCGA 1 cut(s) 158
TasI AATT 4 cut(s) 66, 94, 250, 440
TfiI GAWTC 1 cut(s) 155
Tru1I TTAA 3 cut(s) 93, 249, 365
Tru9I TTAA 3 cut(s) 93, 249, 365
TscAI CASTG 2 cut(s) 93, 317
TspRI CASTG 2 cut(s) 93, 317
XceI RCATGY 1 cut(s) 372
XcmI CCANNNNNNNNNTGG 1 cut(s) 328
XspI CTAG 1 cut(s) 203
Zsp2I ATGCAT 1 cut(s) 411
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.