Rh6CG169900

Belongs to the thiolase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
23280585 .. 23289368
8784 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG169900.1

Sequence Viewer

Length: 201 bp
ATGACTCTAAGCACCCAAGGGAATCCTAGAATGAGTACTGGACTACCGATTGTGGACCCAAAAACTGGAGAGGAGAGGCATGTTAGAATTTATGTGGATGATGGCATCCGGCCAAATGCAAACATGACTGATTTGGCAAAATTGAAGCCTGCATTTAAATCAGATGGGACAACAACTGTAGGAAATGCTAGCCAGCATTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.14

Weight (kDa)

8.18

Isoelectric Point (pI)

10.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Thiolase_N PF00108 28 - 65 1.9e-08 Thiolase, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 65
AcoI YGGCCR 1 cut(s) 110
AcsI RAATTY 1 cut(s) 87
AfaI GTAC 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 65
AgsI TTSAA 1 cut(s) 145
AoxI GGCC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 87
AspS9I GGNCC 1 cut(s) 55
AsuNHI GCTAGC 1 cut(s) 188
AvaII GGWCC 1 cut(s) 55
BccI CCATC 2 cut(s) 95, 158
BfaI CTAG 2 cut(s) 27, 189
BfmI CTRYAG 1 cut(s) 177
BmcAI AGTACT 1 cut(s) 37
Bme18I GGWCC 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 55
BmiI GGNNCC 1 cut(s) 57
BmsI GCATC 1 cut(s) 114
BmtI GCTAGC 1 cut(s) 192
BpmI CTGGAG 1 cut(s) 87
BsaJI CCNNGG 1 cut(s) 16
Bsc4I CCNNNNNNNGG 1 cut(s) 65
Bse1I ACTGG 2 cut(s) 43, 70
BseDI CCNNGG 1 cut(s) 16
BseGI GGATG 2 cut(s) 103, 105
BseLI CCNNNNNNNGG 1 cut(s) 65
BseNI ACTGG 2 cut(s) 43, 70
BseRI GAGGAG 1 cut(s) 86
BshFI GGCC 1 cut(s) 112
BsiSI CCGG 1 cut(s) 109
BslFI GGGAC 1 cut(s) 181
BslI CCNNNNNNNGG 1 cut(s) 65
BsmFI GGGAC 1 cut(s) 181
BsnI GGCC 1 cut(s) 112
BspANI GGCC 1 cut(s) 112
BspLI GGNNCC 1 cut(s) 57
BspOI GCTAGC 1 cut(s) 192
BsrI ACTGG 2 cut(s) 43, 70
BssECI CCNNGG 1 cut(s) 16
BssT1I CCWWGG 1 cut(s) 16
Bst4CI ACNGT 1 cut(s) 178
BstC8I GCNNGC 3 cut(s) 150, 190, 194
BstDEI CTNAG 1 cut(s) 8
BstF5I GGATG 2 cut(s) 103, 105
BstNSI RCATGY 1 cut(s) 83
BstSFI CTRYAG 1 cut(s) 177
BsuRI GGCC 1 cut(s) 112
BtsCI GGATG 2 cut(s) 103, 105
Cac8I GCNNGC 3 cut(s) 150, 190, 194
Cfr13I GGNCC 1 cut(s) 55
Csp6I GTAC 1 cut(s) 36
CviAII CATG 2 cut(s) 80, 124
CviJI RGCY 3 cut(s) 112, 148, 192
CviKI_1 RGCY 3 cut(s) 112, 148, 192
CviQI GTAC 1 cut(s) 36
DdeI CTNAG 1 cut(s) 8
DraI TTTAAA 1 cut(s) 157
EaeI YGGCCR 1 cut(s) 110
Eco130I CCWWGG 1 cut(s) 16
Eco47I GGWCC 1 cut(s) 55
EcoT14I CCWWGG 1 cut(s) 16
ErhI CCWWGG 1 cut(s) 16
FaeI CATG 2 cut(s) 83, 127
FaiI YATR 3 cut(s) 81, 93, 125
FaqI GGGAC 1 cut(s) 181
FatI CATG 2 cut(s) 79, 123
FokI GGATG 2 cut(s) 92, 110
FspBI CTAG 2 cut(s) 27, 189
GsuI CTGGAG 1 cut(s) 87
HaeIII GGCC 1 cut(s) 112
HapII CCGG 1 cut(s) 109
Hin1II CATG 2 cut(s) 83, 127
HinfI GANTC 2 cut(s) 4, 22
HpaII CCGG 1 cut(s) 109
Hpy166II GTNNAC 1 cut(s) 55
Hpy188I TCNGA 1 cut(s) 163
Hpy8I GTNNAC 1 cut(s) 55
HpyCH4III ACNGT 1 cut(s) 178
HpyCH4V TGCA 2 cut(s) 119, 152
HpyF3I CTNAG 1 cut(s) 8
Hsp92II CATG 2 cut(s) 83, 127
LpnPI CCDG 4 cut(s) 24, 51, 122, 162
LweI GCATC 1 cut(s) 114
MaeI CTAG 2 cut(s) 27, 189
MluCI AATT 2 cut(s) 87, 140
MnlI CCTC 2 cut(s) 64, 69
MseI TTAA 1 cut(s) 156
MspI CCGG 1 cut(s) 109
NheI GCTAGC 1 cut(s) 188
NlaIII CATG 2 cut(s) 83, 127
NlaIV GGNNCC 1 cut(s) 57
NspI RCATGY 1 cut(s) 83
PfeI GAWTC 1 cut(s) 22
PflMI CCANNNNNTGG 1 cut(s) 65
PspN4I GGNNCC 1 cut(s) 57
PspPI GGNCC 1 cut(s) 55
RsaI GTAC 1 cut(s) 37
RsaNI GTAC 1 cut(s) 36
SaqAI TTAA 1 cut(s) 156
Sau96I GGNCC 1 cut(s) 55
ScaI AGTACT 1 cut(s) 37
SfaNI GCATC 1 cut(s) 114
SfcI CTRYAG 1 cut(s) 177
SgeI CNNG 8 cut(s) 29, 39, 51, 78, 92, 121, 136, 161
SinI GGWCC 1 cut(s) 55
SmiI ATTTAAAT 1 cut(s) 157
Sse9I AATT 2 cut(s) 87, 140
SspMI CTAG 2 cut(s) 27, 189
StyI CCWWGG 1 cut(s) 16
SwaI ATTTAAAT 1 cut(s) 157
TaaI ACNGT 1 cut(s) 178
TasI AATT 2 cut(s) 87, 140
TatI WGTACW 1 cut(s) 35
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
Van91I CCANNNNNTGG 1 cut(s) 65
VpaK11BI GGWCC 1 cut(s) 55
XapI RAATTY 1 cut(s) 87
XceI RCATGY 1 cut(s) 83
XspI CTAG 2 cut(s) 27, 189
ZrmI AGTACT 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.