Rh2DG209400

Belongs to the thiolase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
19725378 .. 19734962
9585 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG209400.1

Sequence Viewer

Length: 204 bp
ATGAAACACACCATTTTTGCTCTTCTTATTCTTATTTTTGTCCTGCTCTGTATTATGGACCCAAAAACTGGAGAGGAGAGGCATGTTACAATTTATGTGAATCATGGCATCCGGCCAAATGCAAACATGACTGATTTGGCGAAATTGAAGCCTGCATTTAAATCAGATGGGACAACAACTGCAGAATATGATCAAAAACAATGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.6

Weight (kDa)

7.92

Isoelectric Point (pI)

18.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 68
AcoI YGGCCR 1 cut(s) 113
AfiI CCNNNNNNNGG 1 cut(s) 68
AgsI TTSAA 1 cut(s) 148
AoxI GGCC 1 cut(s) 113
AspS9I GGNCC 1 cut(s) 58
AvaII GGWCC 1 cut(s) 58
BccI CCATC 1 cut(s) 161
BclI TGATCA 1 cut(s) 190
BfmI CTRYAG 1 cut(s) 180
Bme18I GGWCC 1 cut(s) 58
BmgT120I GGNCC 1 cut(s) 58
BmiI GGNNCC 1 cut(s) 60
BmsI GCATC 1 cut(s) 117
BpmI CTGGAG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 73
BseGI GGATG 1 cut(s) 108
BseLI CCNNNNNNNGG 1 cut(s) 68
BseNI ACTGG 1 cut(s) 73
BseRI GAGGAG 1 cut(s) 89
BshFI GGCC 1 cut(s) 115
BsiSI CCGG 1 cut(s) 112
BslFI GGGAC 1 cut(s) 184
BslI CCNNNNNNNGG 1 cut(s) 68
BsmFI GGGAC 1 cut(s) 184
BsnI GGCC 1 cut(s) 115
Bsp143I GATC 1 cut(s) 190
BspANI GGCC 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 60
BspMAI CTGCAG 1 cut(s) 184
BspQI GCTCTTC 1 cut(s) 27
BsrI ACTGG 1 cut(s) 73
BssMI GATC 1 cut(s) 190
Bst6I CTCTTC 1 cut(s) 27
BstC8I GCNNGC 1 cut(s) 153
BstF5I GGATG 1 cut(s) 108
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstNSI RCATGY 1 cut(s) 86
BstSFI CTRYAG 1 cut(s) 180
BsuRI GGCC 1 cut(s) 115
BtsCI GGATG 1 cut(s) 108
Cac8I GCNNGC 1 cut(s) 153
Cfr13I GGNCC 1 cut(s) 58
CviAII CATG 3 cut(s) 83, 104, 127
CviJI RGCY 2 cut(s) 115, 151
CviKI_1 RGCY 2 cut(s) 115, 151
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
DraI TTTAAA 1 cut(s) 160
EaeI YGGCCR 1 cut(s) 113
Eam1104I CTCTTC 1 cut(s) 27
EarI CTCTTC 1 cut(s) 27
Eco47I GGWCC 1 cut(s) 58
FaeI CATG 3 cut(s) 86, 107, 130
FaiI YATR 6 cut(s) 56, 84, 96, 105, 128, 189
FaqI GGGAC 1 cut(s) 184
FatI CATG 3 cut(s) 82, 103, 126
FbaI TGATCA 1 cut(s) 190
FokI GGATG 1 cut(s) 95
GsuI CTGGAG 1 cut(s) 90
HaeIII GGCC 1 cut(s) 115
HapII CCGG 1 cut(s) 112
Hin1II CATG 3 cut(s) 86, 107, 130
HinfI GANTC 1 cut(s) 100
HpaII CCGG 1 cut(s) 112
Hpy188I TCNGA 1 cut(s) 166
HpyCH4V TGCA 3 cut(s) 122, 155, 182
Hsp92II CATG 3 cut(s) 86, 107, 130
Ksp22I TGATCA 1 cut(s) 190
Kzo9I GATC 1 cut(s) 190
LguI GCTCTTC 1 cut(s) 27
LpnPI CCDG 4 cut(s) 54, 56, 125, 165
LweI GCATC 1 cut(s) 117
MaeIII GTNAC 1 cut(s) 85
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 1 cut(s) 14
MluCI AATT 2 cut(s) 90, 143
MnlI CCTC 2 cut(s) 67, 72
MseI TTAA 1 cut(s) 159
MspI CCGG 1 cut(s) 112
NdeII GATC 1 cut(s) 190
NlaIII CATG 3 cut(s) 86, 107, 130
NlaIV GGNNCC 1 cut(s) 60
NspI RCATGY 1 cut(s) 86
PciSI GCTCTTC 1 cut(s) 27
PfeI GAWTC 1 cut(s) 100
PflMI CCANNNNNTGG 1 cut(s) 68
PspN4I GGNNCC 1 cut(s) 60
PspPI GGNCC 1 cut(s) 58
PstI CTGCAG 1 cut(s) 184
SapI GCTCTTC 1 cut(s) 27
SaqAI TTAA 1 cut(s) 159
Sau3AI GATC 1 cut(s) 190
Sau96I GGNCC 1 cut(s) 58
SfaNI GCATC 1 cut(s) 117
SfcI CTRYAG 1 cut(s) 180
SgeI CNNG 7 cut(s) 55, 81, 95, 116, 124, 139, 164
SinI GGWCC 1 cut(s) 58
SmiI ATTTAAAT 1 cut(s) 160
Sse9I AATT 2 cut(s) 90, 143
SwaI ATTTAAAT 1 cut(s) 160
TasI AATT 2 cut(s) 90, 143
TfiI GAWTC 1 cut(s) 100
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 68
VpaK11BI GGWCC 1 cut(s) 58
XceI RCATGY 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.