Rh6AG179700

DEAD-box ATP-dependent RNA helicase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
31158162 .. 31169383
11222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG179700.1

Sequence Viewer

Length: 207 bp
ATGTTGAAAAGGACTGCAGCAGTTCAAAATAACTTTTATGATTTTTTTTCTTTTATGAATAGACAAACAGCTTTATTTTCTGCAACCCAGACTAAGAAGGTTGAAGATCTTGCTAACTTTTCCTTCCAGACAACGCCTATGTATATAGATGTGGATGATGGGAGAACTAAGGTAGGAATCCAACTGGTCTTTTGGATTCCACACTAA

Protein Analysis

68

Amino Acids

7.94

Weight (kDa)

8.12

Isoelectric Point (pI)

15.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 7, 26, 104
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
ApeKI GCWGC 1 cut(s) 17
BbvI GCAGC 1 cut(s) 29
BccI CCATC 1 cut(s) 152
BfmI CTRYAG 1 cut(s) 15
BglII AGATCT 1 cut(s) 106
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
Bse1I ACTGG 1 cut(s) 189
BseGI GGATG 1 cut(s) 160
BseNI ACTGG 1 cut(s) 189
BseXI GCAGC 1 cut(s) 29
Bsp143I GATC 1 cut(s) 106
BspMAI CTGCAG 1 cut(s) 19
BsrI ACTGG 1 cut(s) 189
BssMI GATC 1 cut(s) 106
BstDEI CTNAG 2 cut(s) 93, 168
BstF5I GGATG 1 cut(s) 160
BstKTI GATC 1 cut(s) 109
BstMBI GATC 1 cut(s) 106
BstSFI CTRYAG 1 cut(s) 15
BstV1I GCAGC 1 cut(s) 29
BstX2I RGATCY 1 cut(s) 106
BstYI RGATCY 1 cut(s) 106
BtsCI GGATG 1 cut(s) 160
CviJI RGCY 1 cut(s) 71
CviKI_1 RGCY 1 cut(s) 71
DdeI CTNAG 2 cut(s) 93, 168
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
FaiI YATR 5 cut(s) 39, 56, 140, 144, 146
Fnu4HI GCNGC 1 cut(s) 18
FokI GGATG 1 cut(s) 167
Fsp4HI GCNGC 1 cut(s) 18
GluI GCNGC 1 cut(s) 18
HinfI GANTC 2 cut(s) 177, 196
Hpy188III TCNNGA 1 cut(s) 127
HpyAV CCTTC 2 cut(s) 91, 133
HpyCH4V TGCA 2 cut(s) 17, 83
HpyF3I CTNAG 2 cut(s) 93, 168
Kzo9I GATC 1 cut(s) 106
LpnPI CCDG 3 cut(s) 101, 140, 170
Lsp1109I GCAGC 1 cut(s) 29
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MboII GAAGA 1 cut(s) 116
MflI RGATCY 1 cut(s) 106
MmeI TCCRAC 1 cut(s) 205
NdeII GATC 1 cut(s) 106
PfeI GAWTC 2 cut(s) 177, 196
PkrI GCNGC 1 cut(s) 19
PstI CTGCAG 1 cut(s) 19
PsuI RGATCY 1 cut(s) 106
SatI GCNGC 1 cut(s) 18
Sau3AI GATC 1 cut(s) 106
SetI ASST 3 cut(s) 73, 102, 174
SfcI CTRYAG 1 cut(s) 15
SgeI CNNG 4 cut(s) 100, 122, 139, 197
TfiI GAWTC 2 cut(s) 177, 196
TseI GCWGC 1 cut(s) 17
TspDTI ATGAA 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.