Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8232047.1

Orthogroup ID

OG0001933

Physical Location & Seq

Genomic Coordinates Reverse (-)

308 .. 712

Gene Structure 405 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8232047.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 405 bp

atggttgctagaaaaatccgaggttcagttatatgcactacaagcgttgcaagttcacttggaggtacagctccacatgcttatacaacatcgaaacatgccttaatcgggttggtgagatcggcttgcagtgagcttggtgcttatgggattcgagtgaactccatttccccatttggtgttgcaacccctctttcgtgcaaggcttataacttggagccgaaagaggtcgaagccaatagtagtgtcattgcaaacttgaaggggactgtgttgaaggctaggcatatcgcagaggcagctatgtttcttgcttcagatgaatcctgttacgttagcggacacaacttggttgttgatggaggcttctcggtggttgatcacagtattccacccgccaactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

adh_short adh_short_C2

Protein Analysis

134

Amino Acids

13.86

Weight (kDa)

8.4

Isoelectric Point (pI)

38.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001933)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g23771 FvH4_3g25650 FvH4_3g25660
malus_domestica	MD11G1171900.v1.1 MD11G1172300.v1.1 MD12G1032600.v1.1
prunus_persica	Prupe.6G138400_v2.0.a1 Prupe.6G138600_v2.0.a1 Prupe.6G138700_v2.0.a1 Prupe.6G138800_v2.0.a1
pyrus_communis	pycom11g14280 pycom11g14340 pycom11g14350 pycom11g14410
rosa_chinensis	RchiOBHm_Chr5g0047121 RchiOBHm_Chr5g0047151
rosa_laevigata	RLG00000034467 RLG00000034469 RLG00000034471 RLG00000034472 RLG00000034473
rosa_multiflora	Rmu_co8232047.1_g000001 Rmu_co8263687.1_g000001 Rmu_sc0001565.1_g000029 Rmu_sc0003154.1_g000029 Rmu_sc0005145.1_g000014 Rmu_sc0019535.1_g000001
rosa_roxburghii	Rroxscaffold_1G00034260 Rroxscaffold_1G00034290 Rroxscaffold_1G00034310
rosa_rugosa	Rorug05G0234100 Rorug05G0234200 Rorug05G0234400 Rorug05G0234500 Rorug05G0234700
rosa_samantha	Rh5AG313100 Rh5AG313200 Rh5BG322100 Rh5CG348500 Rh5CG348600 Rh5CG348700 Rh5CG348900 Rh5CG349100 Rh5DG333100 Rh5DG333200
rosa_wichuraiana	Rw5G029250

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	210
AciI	CCGC	2 cut(s)	339, 396
AcuI	CTGAAG	1 cut(s)	300
AfaI	GTAC	1 cut(s)	67
AfiI	CCNNNNNNNGG	1 cut(s)	108
AgsI	TTSAA	2 cut(s)	262, 277
AloI	GAACNNNNNNTCC	2 cut(s)	152, 184
AluBI	AGCT	3 cut(s)	71, 136, 302
AluI	AGCT	3 cut(s)	71, 136, 302
ApeKI	GCWGC	1 cut(s)	299
AsuHPI	GGTGA	1 cut(s)	127
BbvI	GCAGC	1 cut(s)	311
BccI	CCATC	1 cut(s)	353
BclI	TGATCA	1 cut(s)	379
BfaI	CTAG	2 cut(s)	9, 282
BisI	GCNGC	1 cut(s)	300
BlsI	GCNGC	1 cut(s)	301
BmiI	GGNNCC	1 cut(s)	219
BsaJI	CCNNGG	1 cut(s)	19
Bsc4I	CCNNNNNNNGG	1 cut(s)	108
Bse3DI	GCAATG	1 cut(s)	249
BseDI	CCNNGG	1 cut(s)	19
BseLI	CCNNNNNNNGG	1 cut(s)	108
BseMI	GCAATG	1 cut(s)	249
BseXI	GCAGC	1 cut(s)	311
BslFI	GGGAC	1 cut(s)	280
BslI	CCNNNNNNNGG	1 cut(s)	108
BsmFI	GGGAC	1 cut(s)	280
Bsp143I	GATC	2 cut(s)	119, 379
BspACI	CCGC	2 cut(s)	339, 396
BspLI	GGNNCC	1 cut(s)	219
BsrDI	GCAATG	1 cut(s)	249
BssECI	CCNNGG	1 cut(s)	19
BssMI	GATC	2 cut(s)	119, 379
Bst4CI	ACNGT	2 cut(s)	271, 386
BstC8I	GCNNGC	1 cut(s)	127
BstKTI	GATC	2 cut(s)	122, 382
BstMBI	GATC	2 cut(s)	119, 379
BstMWI	GCNNNNNNNGC	3 cut(s)	42, 77, 299
BstNSI	RCATGY	2 cut(s)	80, 101
BstV1I	GCAGC	1 cut(s)	311
BtsI	GCAGTG	1 cut(s)	136
BtsIMutI	CAGTG	1 cut(s)	136
Cac8I	GCNNGC	1 cut(s)	127
Csp6I	GTAC	1 cut(s)	66
CviAII	CATG	2 cut(s)	77, 98
CviJI	RGCY	9 cut(s)	71, 125, 136, 206, 220, 236, 281, 302, 366
CviKI_1	RGCY	9 cut(s)	71, 125, 136, 206, 220, 236, 281, 302, 366
CviQI	GTAC	1 cut(s)	66
DpnI	GATC	2 cut(s)	121, 381
DpnII	GATC	2 cut(s)	119, 379
Eco57I	CTGAAG	1 cut(s)	300
FaeI	CATG	2 cut(s)	80, 101
FaiI	YATR	9 cut(s)	32, 34, 78, 84, 99, 147, 210, 288, 305
FaqI	GGGAC	1 cut(s)	280
FatI	CATG	2 cut(s)	76, 97
FauI	CCCGC	1 cut(s)	403
FbaI	TGATCA	1 cut(s)	379
Fnu4HI	GCNGC	1 cut(s)	300
Fsp4HI	GCNGC	1 cut(s)	300
FspBI	CTAG	2 cut(s)	9, 282
GluI	GCNGC	1 cut(s)	300
Hin1II	CATG	2 cut(s)	80, 101
HinfI	GANTC	2 cut(s)	151, 323
HphI	GGTGA	1 cut(s)	127
Hpy166II	GTNNAC	2 cut(s)	56, 160
Hpy188I	TCNGA	2 cut(s)	20, 319
Hpy8I	GTNNAC	2 cut(s)	56, 160
HpyAV	CCTTC	2 cut(s)	256, 271
HpyCH4III	ACNGT	2 cut(s)	271, 386
HpyCH4IV	ACGT	1 cut(s)	333
HpyCH4V	TGCA	6 cut(s)	36, 50, 129, 185, 201, 254
HpyF10VI	GCNNNNNNNGC	3 cut(s)	42, 77, 299
HpySE526I	ACGT	1 cut(s)	333
Hsp92II	CATG	2 cut(s)	80, 101
Ksp22I	TGATCA	1 cut(s)	379
Kzo9I	GATC	2 cut(s)	119, 379
LmnI	GCTCC	2 cut(s)	76, 217
LpnPI	CCDG	1 cut(s)	340
Lsp1109I	GCAGC	1 cut(s)	311
MaeI	CTAG	2 cut(s)	9, 282
MaeII	ACGT	1 cut(s)	333
MaeIII	GTNAC	1 cut(s)	329
MalI	GATC	2 cut(s)	121, 381
MboI	GATC	2 cut(s)	119, 379
MnlI	CCTC	6 cut(s)	14, 56, 201, 220, 289, 356
MseI	TTAA	1 cut(s)	104
MwoI	GCNNNNNNNGC	3 cut(s)	42, 77, 299
NdeII	GATC	2 cut(s)	119, 379
NlaIII	CATG	2 cut(s)	80, 101
NlaIV	GGNNCC	1 cut(s)	219
NspI	RCATGY	2 cut(s)	80, 101
PfeI	GAWTC	2 cut(s)	151, 323
PkrI	GCNGC	1 cut(s)	301
PsiI	TTATAA	1 cut(s)	210
PspN4I	GGNNCC	1 cut(s)	219
RsaI	GTAC	1 cut(s)	67
RsaNI	GTAC	1 cut(s)	66
SaqAI	TTAA	1 cut(s)	104
SatI	GCNGC	1 cut(s)	300
Sau3AI	GATC	2 cut(s)	119, 379
SetI	ASST	7 cut(s)	25, 67, 73, 138, 231, 304, 336
SsiI	CCGC	2 cut(s)	339, 396
SspMI	CTAG	2 cut(s)	9, 282
TaaI	ACNGT	2 cut(s)	271, 386
TaiI	ACGT	1 cut(s)	336
TaqI	TCGA	3 cut(s)	92, 154, 231
TfiI	GAWTC	2 cut(s)	151, 323
Tru1I	TTAA	1 cut(s)	104
Tru9I	TTAA	1 cut(s)	104
TscAI	CASTG	1 cut(s)	136
TseI	GCWGC	1 cut(s)	299
TspDTI	ATGAA	1 cut(s)	336
TspRI	CASTG	1 cut(s)	136
XceI	RCATGY	2 cut(s)	80, 101
XspI	CTAG	2 cut(s)	9, 282

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.