Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003154.1

Orthogroup ID

OG0001933

Physical Location & Seq

Genomic Coordinates Reverse (-)

166874 .. 167473

Gene Structure 600 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003154.1_g000029.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 360 bp

atgacgaacgaaaaagtcgttgaaaacgccgtgaacacggctacagccaagtatggaaagctagacattatgttcaacaatgctggcttcagcgatgtggccaagccgaacatcctcaataacaataaggccaatttcgagcagacaccgttgaccaaggaattttttaagctcgacaatgagggagtcagtggtgtttaccccaacctcaaaggggctatgttgaaggcggaagatgtggttgaggctgttcgttacttgggaagtgatgagtccaagtatgttagtaggcataatttggtagtagacaaaggctatactattgtcaactcaaggttctttacatttgagcaatcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

adh_short_C2

Protein Analysis

119

Amino Acids

13.31

Weight (kDa)

5.82

Isoelectric Point (pI)

18.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001933)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g23771 FvH4_3g25650 FvH4_3g25660
malus_domestica	MD11G1171900.v1.1 MD11G1172300.v1.1 MD12G1032600.v1.1
prunus_persica	Prupe.6G138400_v2.0.a1 Prupe.6G138600_v2.0.a1 Prupe.6G138700_v2.0.a1 Prupe.6G138800_v2.0.a1
pyrus_communis	pycom11g14280 pycom11g14340 pycom11g14350 pycom11g14410
rosa_chinensis	RchiOBHm_Chr5g0047121 RchiOBHm_Chr5g0047151
rosa_laevigata	RLG00000034467 RLG00000034469 RLG00000034471 RLG00000034472 RLG00000034473
rosa_multiflora	Rmu_co8232047.1_g000001 Rmu_co8263687.1_g000001 Rmu_sc0001565.1_g000029 Rmu_sc0003154.1_g000029 Rmu_sc0005145.1_g000014 Rmu_sc0019535.1_g000001
rosa_roxburghii	Rroxscaffold_1G00034260 Rroxscaffold_1G00034290 Rroxscaffold_1G00034310
rosa_rugosa	Rorug05G0234100 Rorug05G0234200 Rorug05G0234400 Rorug05G0234500 Rorug05G0234700
rosa_samantha	Rh5AG313100 Rh5AG313200 Rh5BG322100 Rh5CG348500 Rh5CG348600 Rh5CG348700 Rh5CG348900 Rh5CG349100 Rh5DG333100 Rh5DG333200
rosa_wichuraiana	Rw5G029250

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	306
AciI	CCGC	1 cut(s)	230
AcoI	YGGCCR	1 cut(s)	99
AcsI	RAATTY	1 cut(s)	161
AcuI	CTGAAG	1 cut(s)	73
AfiI	CCNNNNNNNGG	1 cut(s)	214
AgsI	TTSAA	3 cut(s)	23, 76, 226
AluBI	AGCT	2 cut(s)	61, 172
AluI	AGCT	2 cut(s)	61, 172
AoxI	GGCC	2 cut(s)	99, 129
ApoI	RAATTY	1 cut(s)	161
BalI	TGGCCA	1 cut(s)	101
BceAI	ACGGC	2 cut(s)	14, 54
BfaI	CTAG	1 cut(s)	62
BfmI	CTRYAG	1 cut(s)	42
BpuEI	CTTGAG	1 cut(s)	316
BsaJI	CCNNGG	1 cut(s)	156
Bsc4I	CCNNNNNNNGG	1 cut(s)	214
BseDI	CCNNGG	1 cut(s)	156
BseGI	GGATG	1 cut(s)	111
BseLI	CCNNNNNNNGG	1 cut(s)	214
BshFI	GGCC	2 cut(s)	101, 131
BslI	CCNNNNNNNGG	1 cut(s)	214
BsnI	GGCC	2 cut(s)	101, 131
BspACI	CCGC	1 cut(s)	230
BspANI	GGCC	2 cut(s)	101, 131
BssECI	CCNNGG	1 cut(s)	156
BssT1I	CCWWGG	1 cut(s)	156
Bst4CI	ACNGT	1 cut(s)	150
BstC8I	GCNNGC	1 cut(s)	85
BstF5I	GGATG	1 cut(s)	111
BstSFI	CTRYAG	1 cut(s)	42
BsuRI	GGCC	2 cut(s)	101, 131
BtgZI	GCGATG	1 cut(s)	108
BtsCI	GGATG	1 cut(s)	111
BtsIMutI	CAGTG	1 cut(s)	196
Cac8I	GCNNGC	1 cut(s)	85
EaeI	YGGCCR	1 cut(s)	99
EciI	GGCGGA	1 cut(s)	245
Eco130I	CCWWGG	1 cut(s)	156
Eco57I	CTGAAG	1 cut(s)	73
EcoT14I	CCWWGG	1 cut(s)	156
ErhI	CCWWGG	1 cut(s)	156
FaiI	YATR	6 cut(s)	54, 71, 221, 282, 294, 318
FblI	GTMKAC	1 cut(s)	306
FokI	GGATG	1 cut(s)	98
FspBI	CTAG	1 cut(s)	62
HaeIII	GGCC	2 cut(s)	101, 131
HincII	GTYRAC	2 cut(s)	153, 328
HindII	GTYRAC	2 cut(s)	153, 328
HinfI	GANTC	2 cut(s)	186, 272
Hpy166II	GTNNAC	5 cut(s)	34, 153, 199, 307, 328
Hpy8I	GTNNAC	5 cut(s)	34, 153, 199, 307, 328
HpyAV	CCTTC	1 cut(s)	220
HpyCH4III	ACNGT	1 cut(s)	150
LpnPI	CCDG	1 cut(s)	69
MaeI	CTAG	1 cut(s)	62
MaeIII	GTNAC	1 cut(s)	254
MboII	GAAGA	1 cut(s)	245
MlsI	TGGCCA	1 cut(s)	101
MluCI	AATT	3 cut(s)	133, 161, 295
MluNI	TGGCCA	1 cut(s)	101
MlyI	GAGTC	2 cut(s)	195, 281
MnlI	CCTC	4 cut(s)	125, 175, 218, 238
Mox20I	TGGCCA	1 cut(s)	101
MscI	TGGCCA	1 cut(s)	101
MseI	TTAA	2 cut(s)	168, 358
Msp20I	TGGCCA	1 cut(s)	101
PcsI	WCGNNNNNNNCGW	1 cut(s)	15
PleI	GAGTC	2 cut(s)	194, 280
PpsI	GAGTC	2 cut(s)	194, 280
SaqAI	TTAA	2 cut(s)	168, 358
SchI	GAGTC	2 cut(s)	195, 281
SetI	ASST	4 cut(s)	63, 174, 210, 338
SfcI	CTRYAG	1 cut(s)	42
SmlI	CTYRAG	1 cut(s)	331
SmoI	CTYRAG	1 cut(s)	331
Sse9I	AATT	3 cut(s)	133, 161, 295
SsiI	CCGC	1 cut(s)	230
SspMI	CTAG	1 cut(s)	62
StyI	CCWWGG	1 cut(s)	156
TaaI	ACNGT	1 cut(s)	150
TaqI	TCGA	2 cut(s)	138, 174
TasI	AATT	3 cut(s)	133, 161, 295
Tru1I	TTAA	2 cut(s)	168, 358
Tru9I	TTAA	2 cut(s)	168, 358
TscAI	CASTG	1 cut(s)	196
TspRI	CASTG	1 cut(s)	196
XapI	RAATTY	1 cut(s)	161
XmiI	GTMKAC	1 cut(s)	306
XspI	CTAG	1 cut(s)	62

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.