Rmu_sc0000247.1_g000003

Wound-induced protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000247.1
Physical Location & Seq
Reverse (-)
12872 .. 13144
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000247.1_g000003.1.cds

Sequence Viewer

Length: 273 bp
atgagtgctggagcagcttgcagggcttggattgtggcaacaagtattggagcagttgaggctctgaaagaccaaggagtttgcagatggaatggggttctgaggtcactgcatcaacatgccaagaccaacatcagatcatattcccaggccatgaaactctctgccacttcttctgcagccatttctaatcagatcaagaggtcaaaagaggagaagctcagaaaagtcatggaattgaactgctggggtcctaatactgttagattttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

9.92

Weight (kDa)

10.23

Isoelectric Point (pI)

51.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000303)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G10265 AT4G10270
fragaria_vesca FvH4_3g21130 FvH4_6g44460 FvH4_6g44461 FvH4_6g44470
malus_domestica MD03G1217500.v1.1 MD09G1096800.v1.1 MD09G1096900.v1.1 MD09G1097000.v1.1 MD09G1097100.v1.1 MD11G1235200.v1.1 MD11G1235300.v1.1 MD17G1085100.v1.1 MD17G1085200.v1.1 MD17G1085300.v1.1 MD17G1085400.v1.1
prunus_persica Prupe.3G228900_v2.0.a1 Prupe.3G229000_v2.0.a1 Prupe.3G229300_v2.0.a1 Prupe.3G229400_v2.0.a1 Prupe.3G229500_v2.0.a1 Prupe.3G229700_v2.0.a1 Prupe.3G229800_v2.0.a1 Prupe.3G229900_v2.0.a1 Prupe.3G230000_v2.0.a1 Prupe.4G191800_v2.0.a1
pyrus_communis pycom03g16710 pycom09g02120 pycom09g02130 pycom1049g00030 pycom11g20680 pycom11g20690 pycom17g08250 pycom17g08260 pycom17g08270 pycom17g08280 pycom17g08290 pycom17g08310
rosa_chinensis RchiOBHm_Chr2g0161421 RchiOBHm_Chr2g0161441 RchiOBHm_Chr2g0161451 RchiOBHm_Chr2g0161461 RchiOBHm_Chr2g0161481 RchiOBHm_Chr2g0161491 RchiOBHm_Chr2g0161501 RchiOBHm_Chr2g0161511 RchiOBHm_Chr5g0036191
rosa_laevigata RLG00000021284 RLG00000021289
rosa_multiflora Rmu_co8259543.1_g000001 Rmu_sc0000247.1_g000003 Rmu_sc0003548.1_g000005 Rmu_sc0003548.1_g000011 Rmu_sc0003548.1_g000014 Rmu_sc0003548.1_g000015 Rmu_sc0003548.1_g000016 Rmu_sc0003548.1_g000017 Rmu_sc0006100.1_g000003 Rmu_sc0013925.1_g000002 Rmu_sc0013925.1_g000003 Rmu_sc0018798.1_g000001 Rmu_sc0040460.1_g000004
rosa_roxburghii Rroxscaffold_1G00044570 Rroxscaffold_2G00088730 Rroxscaffold_2G00088740 Rroxscaffold_2G00088750 Rroxscaffold_2G00088760 Rroxscaffold_2G00088770 Rroxscaffold_2G00088780 Rroxscaffold_2G00088800 Rroxscaffold_2G00088810 Rroxscaffold_2G00088830
rosa_rugosa Rorug02G0489400 Rorug02G0489800 Rorug02G0489900 Rorug02G0490000 Rorug02G0490100 Rorug02G0490200 Rorug02G0490300 Rorug05G0153500
rosa_samantha Rh2AG555700 Rh2AG555900 Rh2AG556100 Rh2AG556200 Rh2AG556300 Rh2AG556400 Rh2AG556500 Rh2BG568900 Rh2BG569100 Rh2BG569200 Rh2BG569400 Rh2BG569600 Rh2BG569700 Rh2BG569800 Rh2BG569900 Rh2CG539600 Rh2CG539800 Rh2CG540200 Rh2CG540300 Rh2CG540400 Rh2DG578500 Rh2DG578700 Rh2DG578800 Rh2DG579000 Rh2DG579100 Rh2DG579200 Rh2DG579300 Rh5BG248200 Rh5CG279600 Rh5DG256500
rosa_wichuraiana Rw2G045960 Rw2G045980 Rw2G046000 Rw2G046010 Rw2G046020 Rw2G046030 Rw2G046040 Rw5G022710

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 241
AjnI CCWGG 1 cut(s) 147
AluBI AGCT 2 cut(s) 17, 220
AluI AGCT 2 cut(s) 17, 220
AoxI GGCC 1 cut(s) 150
ApeKI GCWGC 2 cut(s) 14, 179
AspS9I GGNCC 1 cut(s) 251
AvaII GGWCC 1 cut(s) 251
BbvI GCAGC 2 cut(s) 26, 191
BccI CCATC 1 cut(s) 81
BciT130I CCWGG 1 cut(s) 149
BfmI CTRYAG 1 cut(s) 177
BisI GCNGC 2 cut(s) 15, 180
BlsI GCNGC 2 cut(s) 16, 181
Bme1390I CCNGG 1 cut(s) 149
Bme18I GGWCC 1 cut(s) 251
BmgT120I GGNCC 1 cut(s) 251
BmiI GGNNCC 1 cut(s) 252
BmrFI CCNGG 1 cut(s) 149
BmsI GCATC 1 cut(s) 121
BpmI CTGGAG 1 cut(s) 30
BsaJI CCNNGG 2 cut(s) 73, 147
BseBI CCWGG 1 cut(s) 149
BseDI CCNNGG 2 cut(s) 73, 147
BseMII CTCAG 2 cut(s) 92, 235
BseRI GAGGAG 1 cut(s) 227
BseXI GCAGC 2 cut(s) 26, 191
BseYI CCCAGC 1 cut(s) 246
BshFI GGCC 1 cut(s) 152
BsnI GGCC 1 cut(s) 152
Bsp143I GATC 2 cut(s) 137, 195
BspANI GGCC 1 cut(s) 152
BspCNI CTCAG 2 cut(s) 93, 234
BspLI GGNNCC 1 cut(s) 252
BspMAI CTGCAG 1 cut(s) 181
BssECI CCNNGG 2 cut(s) 73, 147
BssMI GATC 2 cut(s) 137, 195
BssT1I CCWWGG 1 cut(s) 73
Bst2UI CCWGG 1 cut(s) 149
Bst4CI ACNGT 1 cut(s) 262
BstC8I GCNNGC 1 cut(s) 19
BstDEI CTNAG 2 cut(s) 101, 221
BstKTI GATC 2 cut(s) 140, 198
BstMBI GATC 2 cut(s) 137, 195
BstMWI GCNNNNNNNGC 3 cut(s) 14, 23, 59
BstNI CCWGG 1 cut(s) 149
BstNSI RCATGY 1 cut(s) 122
BstSCI CCNGG 1 cut(s) 147
BstSFI CTRYAG 1 cut(s) 177
BstV1I GCAGC 2 cut(s) 26, 191
BsuRI GGCC 1 cut(s) 152
BtsI GCAGTG 1 cut(s) 107
BtsIMutI CAGTG 1 cut(s) 107
Cac8I GCNNGC 1 cut(s) 19
Cfr13I GGNCC 1 cut(s) 251
CviAII CATG 3 cut(s) 119, 154, 232
CviJI RGCY 6 cut(s) 17, 26, 62, 152, 182, 220
CviKI_1 RGCY 6 cut(s) 17, 26, 62, 152, 182, 220
DdeI CTNAG 2 cut(s) 101, 221
DpnI GATC 2 cut(s) 139, 197
DpnII GATC 2 cut(s) 137, 195
Eco130I CCWWGG 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 251
EcoO109I RGGNCCY 1 cut(s) 251
EcoRII CCWGG 1 cut(s) 147
EcoT14I CCWWGG 1 cut(s) 73
ErhI CCWWGG 1 cut(s) 73
FaeI CATG 3 cut(s) 122, 157, 235
FaiI YATR 4 cut(s) 120, 142, 155, 233
FatI CATG 3 cut(s) 118, 153, 231
Fnu4HI GCNGC 2 cut(s) 15, 180
Fsp4HI GCNGC 2 cut(s) 15, 180
GluI GCNGC 2 cut(s) 15, 180
GsaI CCCAGC 1 cut(s) 250
GsuI CTGGAG 1 cut(s) 30
HaeIII GGCC 1 cut(s) 152
Hin1II CATG 3 cut(s) 122, 157, 235
Hpy188I TCNGA 5 cut(s) 66, 102, 137, 195, 224
Hpy188III TCNNGA 1 cut(s) 199
HpyCH4III ACNGT 1 cut(s) 262
HpyCH4V TGCA 4 cut(s) 21, 84, 112, 179
HpyF10VI GCNNNNNNNGC 3 cut(s) 14, 23, 59
HpyF3I CTNAG 2 cut(s) 101, 221
Hsp92II CATG 3 cut(s) 122, 157, 235
Kzo9I GATC 2 cut(s) 137, 195
LmnI GCTCC 2 cut(s) 11, 50
LpnPI CCDG 4 cut(s) 7, 134, 161, 232
Lsp1109I GCAGC 2 cut(s) 26, 191
LweI GCATC 1 cut(s) 121
MaeIII GTNAC 1 cut(s) 105
MalI GATC 2 cut(s) 139, 197
MboI GATC 2 cut(s) 137, 195
MboII GAAGA 1 cut(s) 165
MluCI AATT 1 cut(s) 236
MnlI CCTC 4 cut(s) 52, 96, 195, 205
MslI CAYNNNNRTG 1 cut(s) 117
MspR9I CCNGG 1 cut(s) 149
MvaI CCWGG 1 cut(s) 149
MwoI GCNNNNNNNGC 3 cut(s) 14, 23, 59
NdeII GATC 2 cut(s) 137, 195
NlaIII CATG 3 cut(s) 122, 157, 235
NlaIV GGNNCC 1 cut(s) 252
NmuCI GTSAC 1 cut(s) 105
NspI RCATGY 1 cut(s) 122
PkrI GCNGC 2 cut(s) 16, 181
PpuMI RGGWCCY 1 cut(s) 251
Psp5II RGGWCCY 1 cut(s) 251
Psp6I CCWGG 1 cut(s) 147
PspFI CCCAGC 1 cut(s) 246
PspGI CCWGG 1 cut(s) 147
PspN4I GGNNCC 1 cut(s) 252
PspPI GGNCC 1 cut(s) 251
PspPPI RGGWCCY 1 cut(s) 251
PstI CTGCAG 1 cut(s) 181
RseI CAYNNNNRTG 1 cut(s) 117
SatI GCNGC 2 cut(s) 15, 180
Sau3AI GATC 2 cut(s) 137, 195
Sau96I GGNCC 1 cut(s) 251
ScrFI CCNGG 1 cut(s) 149
SetI ASST 4 cut(s) 19, 107, 206, 222
SfaNI GCATC 1 cut(s) 121
SfcI CTRYAG 1 cut(s) 177
SinI GGWCC 1 cut(s) 251
SmiMI CAYNNNNRTG 1 cut(s) 117
Sse9I AATT 1 cut(s) 236
StyD4I CCNGG 1 cut(s) 147
StyI CCWWGG 1 cut(s) 73
TaaI ACNGT 1 cut(s) 262
TasI AATT 1 cut(s) 236
TscAI CASTG 1 cut(s) 114
TseFI GTSAC 1 cut(s) 105
TseI GCWGC 2 cut(s) 14, 179
Tsp45I GTSAC 1 cut(s) 105
TspDTI ATGAA 1 cut(s) 170
TspRI CASTG 1 cut(s) 114
VpaK11BI GGWCC 1 cut(s) 251
XceI RCATGY 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.