Rmu_sc0006100.1_g000003

Wound induced protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006100.1
Physical Location & Seq
Reverse (-)
7359 .. 7631
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006100.1_g000003.1.cds

Sequence Viewer

Length: 273 bp
atgagtaatacctcaagaacaagcaaggctattgttgccacaactgtcggagttgtggaagcattgaaggatcaaggaatctgcagatggaactccaccattagatccatgcaccaacaagccaagacccagttcaggtccttttctcaggccaacaccaagctatctgcttcttcaacctcggctttgagcagagtccgagatgaaaaggtcaagaagtcagaggagtctttgagaacagtcatgttcttgagctgctggggtcccaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

9.98

Weight (kDa)

10.37

Isoelectric Point (pI)

54.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000303)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G10265 AT4G10270
fragaria_vesca FvH4_3g21130 FvH4_6g44460 FvH4_6g44461 FvH4_6g44470
malus_domestica MD03G1217500.v1.1 MD09G1096800.v1.1 MD09G1096900.v1.1 MD09G1097000.v1.1 MD09G1097100.v1.1 MD11G1235200.v1.1 MD11G1235300.v1.1 MD17G1085100.v1.1 MD17G1085200.v1.1 MD17G1085300.v1.1 MD17G1085400.v1.1
prunus_persica Prupe.3G228900_v2.0.a1 Prupe.3G229000_v2.0.a1 Prupe.3G229300_v2.0.a1 Prupe.3G229400_v2.0.a1 Prupe.3G229500_v2.0.a1 Prupe.3G229700_v2.0.a1 Prupe.3G229800_v2.0.a1 Prupe.3G229900_v2.0.a1 Prupe.3G230000_v2.0.a1 Prupe.4G191800_v2.0.a1
pyrus_communis pycom03g16710 pycom09g02120 pycom09g02130 pycom1049g00030 pycom11g20680 pycom11g20690 pycom17g08250 pycom17g08260 pycom17g08270 pycom17g08280 pycom17g08290 pycom17g08310
rosa_chinensis RchiOBHm_Chr2g0161421 RchiOBHm_Chr2g0161441 RchiOBHm_Chr2g0161451 RchiOBHm_Chr2g0161461 RchiOBHm_Chr2g0161481 RchiOBHm_Chr2g0161491 RchiOBHm_Chr2g0161501 RchiOBHm_Chr2g0161511 RchiOBHm_Chr5g0036191
rosa_laevigata RLG00000021284 RLG00000021289
rosa_multiflora Rmu_co8259543.1_g000001 Rmu_sc0000247.1_g000003 Rmu_sc0003548.1_g000005 Rmu_sc0003548.1_g000011 Rmu_sc0003548.1_g000014 Rmu_sc0003548.1_g000015 Rmu_sc0003548.1_g000016 Rmu_sc0003548.1_g000017 Rmu_sc0006100.1_g000003 Rmu_sc0013925.1_g000002 Rmu_sc0013925.1_g000003 Rmu_sc0018798.1_g000001 Rmu_sc0040460.1_g000004
rosa_roxburghii Rroxscaffold_1G00044570 Rroxscaffold_2G00088730 Rroxscaffold_2G00088740 Rroxscaffold_2G00088750 Rroxscaffold_2G00088760 Rroxscaffold_2G00088770 Rroxscaffold_2G00088780 Rroxscaffold_2G00088800 Rroxscaffold_2G00088810 Rroxscaffold_2G00088830
rosa_rugosa Rorug02G0489400 Rorug02G0489800 Rorug02G0489900 Rorug02G0490000 Rorug02G0490100 Rorug02G0490200 Rorug02G0490300 Rorug05G0153500
rosa_samantha Rh2AG555700 Rh2AG555900 Rh2AG556100 Rh2AG556200 Rh2AG556300 Rh2AG556400 Rh2AG556500 Rh2BG568900 Rh2BG569100 Rh2BG569200 Rh2BG569400 Rh2BG569600 Rh2BG569700 Rh2BG569800 Rh2BG569900 Rh2CG539600 Rh2CG539800 Rh2CG540200 Rh2CG540300 Rh2CG540400 Rh2DG578500 Rh2DG578700 Rh2DG578800 Rh2DG579000 Rh2DG579100 Rh2DG579200 Rh2DG579300 Rh5BG248200 Rh5CG279600 Rh5DG256500
rosa_wichuraiana Rw2G045960 Rw2G045980 Rw2G046000 Rw2G046010 Rw2G046020 Rw2G046030 Rw2G046040 Rw5G022710

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 78, 99
AfiI CCNNNNNNNGG 1 cut(s) 135
AgsI TTSAA 2 cut(s) 67, 177
AjuI GAANNNNNNNTTGG 2 cut(s) 116, 148
AluBI AGCT 2 cut(s) 163, 255
AluI AGCT 2 cut(s) 163, 255
AlwI GGATC 2 cut(s) 78, 99
AoxI GGCC 1 cut(s) 150
ApeKI GCWGC 1 cut(s) 255
AspS9I GGNCC 2 cut(s) 138, 263
AvaII GGWCC 2 cut(s) 138, 263
BbvI GCAGC 1 cut(s) 242
BccI CCATC 1 cut(s) 81
BfaI CTAG 1 cut(s) 271
BfmI CTRYAG 1 cut(s) 82
BisI GCNGC 1 cut(s) 256
BlsI GCNGC 1 cut(s) 257
Bme18I GGWCC 2 cut(s) 138, 263
BmgT120I GGNCC 2 cut(s) 138, 263
BmiI GGNNCC 2 cut(s) 264, 265
BmrI ACTGGG 1 cut(s) 124
BmuI ACTGGG 1 cut(s) 124
BpuEI CTTGAG 1 cut(s) 271
BsaJI CCNNGG 1 cut(s) 180
Bsc4I CCNNNNNNNGG 1 cut(s) 135
Bse1I ACTGG 1 cut(s) 130
BseDI CCNNGG 1 cut(s) 180
BseLI CCNNNNNNNGG 1 cut(s) 135
BseMII CTCAG 1 cut(s) 161
BseNI ACTGG 1 cut(s) 130
BseRI GAGGAG 1 cut(s) 239
BseXI GCAGC 1 cut(s) 242
BseYI CCCAGC 1 cut(s) 258
BshFI GGCC 1 cut(s) 152
BslFI GGGAC 1 cut(s) 249
BslI CCNNNNNNNGG 1 cut(s) 135
BsmFI GGGAC 1 cut(s) 249
BsnI GGCC 1 cut(s) 152
Bsp143I GATC 2 cut(s) 70, 104
BspANI GGCC 1 cut(s) 152
BspCNI CTCAG 1 cut(s) 160
BspLI GGNNCC 2 cut(s) 264, 265
BspMAI CTGCAG 1 cut(s) 86
BspPI GGATC 2 cut(s) 78, 99
BsrI ACTGG 1 cut(s) 130
BssECI CCNNGG 1 cut(s) 180
BssMI GATC 2 cut(s) 70, 104
Bst4CI ACNGT 2 cut(s) 46, 241
BstDEI CTNAG 1 cut(s) 147
BstKTI GATC 2 cut(s) 73, 107
BstMBI GATC 2 cut(s) 70, 104
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstSFI CTRYAG 1 cut(s) 82
BstV1I GCAGC 1 cut(s) 242
BstX2I RGATCY 1 cut(s) 104
BstYI RGATCY 1 cut(s) 104
BsuRI GGCC 1 cut(s) 152
Cfr13I GGNCC 2 cut(s) 138, 263
CviAII CATG 2 cut(s) 109, 244
CviJI RGCY 6 cut(s) 29, 122, 152, 163, 185, 255
CviKI_1 RGCY 6 cut(s) 29, 122, 152, 163, 185, 255
DdeI CTNAG 1 cut(s) 147
DpnI GATC 2 cut(s) 72, 106
DpnII GATC 2 cut(s) 70, 104
Eco47I GGWCC 2 cut(s) 138, 263
EcoO109I RGGNCCY 2 cut(s) 138, 263
FaeI CATG 2 cut(s) 112, 247
FaiI YATR 2 cut(s) 110, 245
FaqI GGGAC 1 cut(s) 249
FatI CATG 2 cut(s) 108, 243
Fnu4HI GCNGC 1 cut(s) 256
Fsp4HI GCNGC 1 cut(s) 256
FspBI CTAG 1 cut(s) 271
GluI GCNGC 1 cut(s) 256
GsaI CCCAGC 1 cut(s) 262
HaeIII GGCC 1 cut(s) 152
Hin1II CATG 2 cut(s) 112, 247
HinfI GANTC 3 cut(s) 78, 195, 227
Hpy188I TCNGA 3 cut(s) 50, 200, 223
Hpy188III TCNNGA 3 cut(s) 15, 214, 250
HpyAV CCTTC 1 cut(s) 61
HpyCH4III ACNGT 2 cut(s) 46, 241
HpyCH4V TGCA 2 cut(s) 84, 112
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 147
Hsp92II CATG 2 cut(s) 112, 247
KflI GGGWCCC 1 cut(s) 263
Kzo9I GATC 2 cut(s) 70, 104
LpnPI CCDG 4 cut(s) 121, 134, 143, 244
Lsp1109I GCAGC 1 cut(s) 242
MaeI CTAG 1 cut(s) 271
MalI GATC 2 cut(s) 72, 106
MboI GATC 2 cut(s) 70, 104
MboII GAAGA 1 cut(s) 165
MflI RGATCY 1 cut(s) 104
MlyI GAGTC 2 cut(s) 204, 236
MmeI TCCRAC 1 cut(s) 28
MnlI CCTC 3 cut(s) 22, 190, 217
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 2 cut(s) 70, 104
NlaIII CATG 2 cut(s) 112, 247
NlaIV GGNNCC 2 cut(s) 264, 265
NmeAIII GCCGAG 1 cut(s) 161
PfeI GAWTC 1 cut(s) 78
PkrI GCNGC 1 cut(s) 257
PleI GAGTC 2 cut(s) 203, 235
PpsI GAGTC 2 cut(s) 203, 235
PpuMI RGGWCCY 2 cut(s) 138, 263
Psp5II RGGWCCY 2 cut(s) 138, 263
PspFI CCCAGC 1 cut(s) 258
PspN4I GGNNCC 2 cut(s) 264, 265
PspPI GGNCC 2 cut(s) 138, 263
PspPPI RGGWCCY 2 cut(s) 138, 263
PstI CTGCAG 1 cut(s) 86
PsuI RGATCY 1 cut(s) 104
SatI GCNGC 1 cut(s) 256
Sau3AI GATC 2 cut(s) 70, 104
Sau96I GGNCC 2 cut(s) 138, 263
SchI GAGTC 2 cut(s) 204, 236
SetI ASST 6 cut(s) 14, 140, 165, 182, 213, 257
SfcI CTRYAG 1 cut(s) 82
SinI GGWCC 2 cut(s) 138, 263
SmlI CTYRAG 2 cut(s) 13, 250
SmoI CTYRAG 2 cut(s) 13, 250
SspMI CTAG 1 cut(s) 271
TaaI ACNGT 2 cut(s) 46, 241
TfiI GAWTC 1 cut(s) 78
TseI GCWGC 1 cut(s) 255
TspDTI ATGAA 1 cut(s) 219
VpaK11BI GGWCC 2 cut(s) 138, 263
XspI CTAG 1 cut(s) 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.