Rmu_sc0001459.1_g000012

Vinorine synthase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001459.1
Physical Location & Seq
Forward (+)
53203 .. 54546
1344 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001459.1_g000012.1.cds

Sequence Viewer

Length: 1344 bp
atgatcatgaaggttgaggttgaggttgtctccagagatcttatcagaccatcttctccaacccctgaccacctccacagatatcaactctcctttcttgaccagatatctcccccagtctttagtcctttggttctattttattcatcatccgaggctgatacaaattttgacattgctgatatatcgaatcggctaaagaaatccctctccgatgtcttggtccaattctacccacttgctggacgagcaaatgacaacatgttcatagactgcaacgacaagggcatacccttcttggaaactcgagttaactgccaactatctgatgttatccaaaacccagttcccagtgaactcaacaagttggttccatttcaactagacgaagttgctgatctagcccttggtgtccaactaaatgtctttgactgtggtggagttgcaattggtgcttgcatttctcacaagattgcagatgctttatcgtttttcatgttcatcaaaacttgggcagccactgctagaaaagatcattatcatcagacagatgatcatgcagttatgtctccacagtttgtatcagccacactgttcccaccaaggaacatatccgggtttaatccacgtgttgggatcgaaaaagagaatatcgtaacaaagaggtttgtgtttgctgcttccaagatagattctcttaaatcaaaatatggtgttaatgataatgatcatgagcatgagcagagcctagaaagttaccaaagaccgccatctcgtgtggaggctctatctgctttcatatggagtcgctatgtggctgcaaccgaagttgggtctgaagcacctgagagggtctatgccattgttcatgctgtgaacctcaggacaaggtttgatccaccactgtcagaatgttctttcgggaatctctaccgaattgcagttacggttccacgtctggatacaggggaggagtgcaatggtcttgtgaggcaggtcagagagcaagtgagtcatattgacaaggattatgtgaagaaattgcaggagggcagtgaacacttgagtttcatcaaacaaagctctgagaatttctacaagggagagatggttacactgagcttcacaagtttgtgcagatttcctctgtatgaagctgattttggatggggaaagcctacttgggtcggctctcctgccctgactttcaataatttggttgtttttatagacactaaatctgggggtggaatagaagcatacattaacatgaaggaaggagatttggctaaaattgaatctgacaaagagttcatttcatttgtttcaagtgagtcaaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

447

Amino Acids

50.14

Weight (kDa)

5.39

Isoelectric Point (pI)

42.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 985
AccB7I CCANNNNNTGG 2 cut(s) 242, 632
AciI CCGC 1 cut(s) 767
AclWI GGATC 2 cut(s) 644, 890
AcsI RAATTY 2 cut(s) 166, 1090
AcuI CTGAAG 1 cut(s) 858
AcvI CACGTG 1 cut(s) 629
AfiI CCNNNNNNNGG 3 cut(s) 242, 632, 831
AflIII ACRYGT 2 cut(s) 261, 628
AgsI TTSAA 4 cut(s) 380, 1210, 1298, 1329
AjiI CACGTC 1 cut(s) 956
AjuI GAANNNNNNNTTGG 6 cut(s) 330, 362, 1146, 1165, 1178, 1197
AluBI AGCT 3 cut(s) 1083, 1122, 1157
AluI AGCT 3 cut(s) 1083, 1122, 1157
Alw26I GTCTC 2 cut(s) 34, 573
AlwI GGATC 2 cut(s) 644, 890
AlwNI CAGNNNCTG 1 cut(s) 521
Ama87I CYCGRG 1 cut(s) 306
ApeKI GCWGC 3 cut(s) 515, 677, 818
ApoI RAATTY 2 cut(s) 166, 1090
AspS9I GGNCC 1 cut(s) 223
AsuC2I CCSGG 1 cut(s) 616
AvaI CYCGRG 1 cut(s) 306
AvaII GGWCC 1 cut(s) 223
AxyI CCTNAGG 1 cut(s) 881
BauI CACGAG 1 cut(s) 774
BbrPI CACGTG 1 cut(s) 629
BbvI GCAGC 3 cut(s) 527, 664, 805
BccI CCATC 4 cut(s) 58, 778, 1102, 1161
BcgI CGANNNNNNTGC 2 cut(s) 297, 331
BciVI GTATCC 1 cut(s) 955
BclI TGATCA 3 cut(s) 3, 553, 727
BcnI CCSGG 1 cut(s) 616
BcoDI GTCTC 2 cut(s) 34, 573
BfaI CTAG 4 cut(s) 383, 401, 525, 749
BfuAI ACCTGC 1 cut(s) 985
BfuI GTATCC 1 cut(s) 955
BglII AGATCT 1 cut(s) 37
BisI GCNGC 3 cut(s) 516, 678, 819
BlsI GCNGC 3 cut(s) 517, 679, 820
Bme1390I CCNGG 1 cut(s) 616
Bme18I GGWCC 1 cut(s) 223
BmeT110I CYCGRG 1 cut(s) 306
BmgBI CACGTC 1 cut(s) 956
BmgT120I GGNCC 1 cut(s) 223
BmiI GGNNCC 2 cut(s) 372, 951
BmrFI CCNGG 1 cut(s) 616
BmrI ACTGGG 3 cut(s) 110, 338, 345
BmsI GCATC 1 cut(s) 469
BmuI ACTGGG 3 cut(s) 110, 338, 345
BplI GAGNNNNNCTC 2 cut(s) 14, 46
BpmI CTGGAG 1 cut(s) 16
BpuEI CTTGAG 1 cut(s) 1084
BpuMI CCSGG 1 cut(s) 616
BsaAI YACGTR 1 cut(s) 629
BsaBI GATNNNNATC 2 cut(s) 537, 726
BsaJI CCNNGG 3 cut(s) 153, 406, 602
BsaXI ACNNNNNCTCC 2 cut(s) 1095, 1125
Bsc4I CCNNNNNNNGG 3 cut(s) 242, 632, 831
Bse1I ACTGG 3 cut(s) 116, 344, 351
Bse21I CCTNAGG 1 cut(s) 881
Bse3DI GCAATG 2 cut(s) 174, 985
Bse8I GATNNNNATC 2 cut(s) 537, 726
BseDI CCNNGG 3 cut(s) 153, 406, 602
BseGI GGATG 2 cut(s) 149, 1172
BseJI GATNNNNATC 2 cut(s) 537, 726
BseLI CCNNNNNNNGG 3 cut(s) 242, 632, 831
BseMI GCAATG 2 cut(s) 174, 985
BseMII CTCAG 4 cut(s) 837, 895, 1077, 1109
BseNI ACTGG 3 cut(s) 116, 344, 351
BseRI GAGGAG 1 cut(s) 986
BseXI GCAGC 3 cut(s) 527, 664, 805
BsgI GTGCAG 1 cut(s) 1156
BsiHKCI CYCGRG 1 cut(s) 306
BsiSI CCGG 1 cut(s) 615
BslI CCNNNNNNNGG 3 cut(s) 242, 632, 831
BsmAI GTCTC 2 cut(s) 34, 573
BsoBI CYCGRG 1 cut(s) 306
Bsp143I GATC 8 cut(s) 3, 37, 397, 532, 553, 636, 727, 895
BspACI CCGC 1 cut(s) 767
BspCNI CTCAG 4 cut(s) 838, 894, 1078, 1110
BspHI TCATGA 2 cut(s) 6, 730
BspLI GGNNCC 2 cut(s) 372, 951
BspMI ACCTGC 1 cut(s) 985
BspPI GGATC 2 cut(s) 644, 890
BsrDI GCAATG 2 cut(s) 174, 985
BsrI ACTGG 3 cut(s) 116, 344, 351
BssECI CCNNGG 3 cut(s) 153, 406, 602
BssMI GATC 8 cut(s) 3, 37, 397, 532, 553, 636, 727, 895
BssSI CACGAG 1 cut(s) 774
BssT1I CCWWGG 2 cut(s) 406, 602
Bst2BI CACGAG 1 cut(s) 774
Bst4CI ACNGT 5 cut(s) 434, 576, 594, 906, 949
BstAPI GCANNNNNTGC 2 cut(s) 452, 521
BstBAI YACGTR 1 cut(s) 629
BstC8I GCNNGC 1 cut(s) 457
BstDEI CTNAG 4 cut(s) 846, 881, 1086, 1118
BstF5I GGATG 2 cut(s) 149, 1172
BstKTI GATC 8 cut(s) 6, 40, 400, 535, 556, 639, 730, 898
BstMAI GTCTC 2 cut(s) 34, 573
BstMBI GATC 8 cut(s) 3, 37, 397, 532, 553, 636, 727, 895
BstMWI GCNNNNNNNGC 5 cut(s) 248, 401, 452, 521, 791
BstNSI RCATGY 1 cut(s) 265
BstSCI CCNGG 1 cut(s) 614
BstV1I GCAGC 3 cut(s) 527, 664, 805
BstX2I RGATCY 1 cut(s) 37
BstYI RGATCY 1 cut(s) 37
Bsu36I CCTNAGG 1 cut(s) 881
BsuI GTATCC 1 cut(s) 955
BtrI CACGTC 1 cut(s) 956
BtsCI GGATG 2 cut(s) 149, 1172
BtsI GCAGTG 2 cut(s) 519, 1060
BtsIMutI CAGTG 6 cut(s) 358, 519, 590, 902, 1060, 1115
BveI ACCTGC 1 cut(s) 985
Cac8I GCNNGC 1 cut(s) 457
CaiI CAGNNNCTG 1 cut(s) 521
CciI TCATGA 2 cut(s) 6, 730
Cfr13I GGNCC 1 cut(s) 223
CviAII CATG 8 cut(s) 7, 262, 496, 557, 731, 737, 869, 1270
DdeI CTNAG 4 cut(s) 846, 881, 1086, 1118
DpnI GATC 8 cut(s) 5, 39, 399, 534, 555, 638, 729, 897
DpnII GATC 8 cut(s) 3, 37, 397, 532, 553, 636, 727, 895
Eco130I CCWWGG 2 cut(s) 406, 602
Eco32I GATATC 2 cut(s) 83, 108
Eco47I GGWCC 1 cut(s) 223
Eco57I CTGAAG 1 cut(s) 858
Eco72I CACGTG 1 cut(s) 629
Eco81I CCTNAGG 1 cut(s) 881
Eco88I CYCGRG 1 cut(s) 306
EcoRV GATATC 2 cut(s) 83, 108
EcoT14I CCWWGG 2 cut(s) 406, 602
ErhI CCWWGG 2 cut(s) 406, 602
FaeI CATG 8 cut(s) 10, 265, 499, 560, 734, 740, 872, 1273
FatI CATG 8 cut(s) 6, 261, 495, 556, 730, 736, 868, 1269
FauNDI CATATG 1 cut(s) 800
FbaI TGATCA 3 cut(s) 3, 553, 727
Fnu4HI GCNGC 3 cut(s) 516, 678, 819
FokI GGATG 2 cut(s) 136, 1179
Fsp4HI GCNGC 3 cut(s) 516, 678, 819
FspBI CTAG 4 cut(s) 383, 401, 525, 749
GluI GCNGC 3 cut(s) 516, 678, 819
GsuI CTGGAG 1 cut(s) 16
HapII CCGG 1 cut(s) 615
Hin1II CATG 8 cut(s) 10, 265, 499, 560, 734, 740, 872, 1273
HincII GTYRAC 1 cut(s) 313
HindII GTYRAC 1 cut(s) 313
HinfI GANTC 7 cut(s) 190, 692, 805, 925, 1012, 1298, 1334
HpaI GTTAAC 1 cut(s) 313
HpaII CCGG 1 cut(s) 615
Hpy166II GTNNAC 4 cut(s) 313, 356, 877, 1058
Hpy188III TCNNGA 7 cut(s) 7, 33, 98, 731, 883, 922, 959
Hpy8I GTNNAC 4 cut(s) 313, 356, 877, 1058
HpyAV CCTTC 4 cut(s) 4, 304, 1267, 1271
HpyCH4III ACNGT 5 cut(s) 434, 576, 594, 906, 949
HpyCH4IV ACGT 2 cut(s) 628, 955
HpyF10VI GCNNNNNNNGC 5 cut(s) 248, 401, 452, 521, 791
HpyF3I CTNAG 4 cut(s) 846, 881, 1086, 1118
HpySE526I ACGT 2 cut(s) 628, 955
Hsp92II CATG 8 cut(s) 10, 265, 499, 560, 734, 740, 872, 1273
Ksp22I TGATCA 3 cut(s) 3, 553, 727
KspAI GTTAAC 1 cut(s) 313
Kzo9I GATC 8 cut(s) 3, 37, 397, 532, 553, 636, 727, 895
Lsp1109I GCAGC 3 cut(s) 527, 664, 805
LweI GCATC 1 cut(s) 469
MaeI CTAG 4 cut(s) 383, 401, 525, 749
MaeII ACGT 2 cut(s) 628, 955
MaeIII GTNAC 4 cut(s) 655, 755, 943, 1111
MalI GATC 8 cut(s) 5, 39, 399, 534, 555, 638, 729, 897
MboI GATC 8 cut(s) 3, 37, 397, 532, 553, 636, 727, 895
MboII GAAGA 2 cut(s) 45, 1048
MfeI CAATTG 1 cut(s) 447
MflI RGATCY 1 cut(s) 37
MluCI AATT 8 cut(s) 166, 227, 447, 936, 1040, 1090, 1213, 1293
MlyI GAGTC 3 cut(s) 814, 1021, 1343
MmeI TCCRAC 2 cut(s) 83, 439
MseI TTAA 5 cut(s) 312, 621, 699, 717, 1266
MslI CAYNNNNRTG 2 cut(s) 735, 1268
MspI CCGG 1 cut(s) 615
MspR9I CCNGG 1 cut(s) 616
MunI CAATTG 1 cut(s) 447
MwoI GCNNNNNNNGC 5 cut(s) 248, 401, 452, 521, 791
NciI CCSGG 1 cut(s) 616
NdeI CATATG 1 cut(s) 800
NdeII GATC 8 cut(s) 3, 37, 397, 532, 553, 636, 727, 895
NlaIII CATG 8 cut(s) 10, 265, 499, 560, 734, 740, 872, 1273
NlaIV GGNNCC 2 cut(s) 372, 951
NspI RCATGY 1 cut(s) 265
PaeR7I CTCGAG 1 cut(s) 306
PagI TCATGA 2 cut(s) 6, 730
PciI ACATGT 1 cut(s) 261
PfeI GAWTC 4 cut(s) 190, 692, 925, 1298
PflMI CCANNNNNTGG 2 cut(s) 242, 632
PkrI GCNGC 3 cut(s) 517, 679, 820
PleI GAGTC 3 cut(s) 813, 1020, 1342
PmaCI CACGTG 1 cut(s) 629
PmlI CACGTG 1 cut(s) 629
PpsI GAGTC 3 cut(s) 813, 1020, 1342
Ppu21I YACGTR 1 cut(s) 629
PscI ACATGT 1 cut(s) 261
PspCI CACGTG 1 cut(s) 629
PspN4I GGNNCC 2 cut(s) 372, 951
PspPI GGNCC 1 cut(s) 223
PspXI VCTCGAGB 1 cut(s) 306
PstNI CAGNNNCTG 1 cut(s) 521
PsuI RGATCY 1 cut(s) 37
RseI CAYNNNNRTG 2 cut(s) 735, 1268
SaqAI TTAA 5 cut(s) 312, 621, 699, 717, 1266
SatI GCNGC 3 cut(s) 516, 678, 819
Sau3AI GATC 8 cut(s) 3, 37, 397, 532, 553, 636, 727, 895
Sau96I GGNCC 1 cut(s) 223
SchI GAGTC 3 cut(s) 814, 1021, 1343
ScrFI CCNGG 1 cut(s) 616
SfaNI GCATC 1 cut(s) 469
Sfr274I CTCGAG 1 cut(s) 306
SinI GGWCC 1 cut(s) 223
SlaI CTCGAG 1 cut(s) 306
SmiMI CAYNNNNRTG 2 cut(s) 735, 1268
SmlI CTYRAG 2 cut(s) 306, 1063
SmoI CTYRAG 2 cut(s) 306, 1063
Sse9I AATT 8 cut(s) 166, 227, 447, 936, 1040, 1090, 1213, 1293
SsiI CCGC 1 cut(s) 767
SspMI CTAG 4 cut(s) 383, 401, 525, 749
StyD4I CCNGG 1 cut(s) 614
StyI CCWWGG 2 cut(s) 406, 602
TaaI ACNGT 5 cut(s) 434, 576, 594, 906, 949
TaiI ACGT 2 cut(s) 631, 958
TaqI TCGA 3 cut(s) 188, 307, 639
TasI AATT 8 cut(s) 166, 227, 447, 936, 1040, 1090, 1213, 1293
TfiI GAWTC 4 cut(s) 190, 692, 925, 1298
Tru1I TTAA 5 cut(s) 312, 621, 699, 717, 1266
Tru9I TTAA 5 cut(s) 312, 621, 699, 717, 1266
TscAI CASTG 6 cut(s) 358, 526, 597, 909, 1060, 1122
TseI GCWGC 3 cut(s) 515, 677, 818
TspRI CASTG 6 cut(s) 358, 526, 597, 909, 1060, 1122
Van91I CCANNNNNTGG 2 cut(s) 242, 632
VpaK11BI GGWCC 1 cut(s) 223
XapI RAATTY 2 cut(s) 166, 1090
XceI RCATGY 1 cut(s) 265
XhoI CTCGAG 1 cut(s) 306
XspI CTAG 4 cut(s) 383, 401, 525, 749
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.