Rorug04G0252700

Vinorine synthase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0000852
Physical Location & Seq
Reverse (-)
42572786 .. 42573823
1038 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0252700.1

Sequence Viewer

Length: 1038 bp
ATGTATTGTAATCAACAACCTCCATTACTATTGATTCCAAGTGAAGAGAGATATACTTGGAATTTATACAACGTCCTAGATAATCAGTTCCTTGATTACCAAGTAAGATTGCCACATAAGCGATTTTGCGGATCTTCAGAAGGATGGTTAATAGCTGTGGAAAGAGATTTGAGGGTAACCCTAATAAATCCATTCCGTAGGGTTAAAGGAACAGATAAGAAAAACTCAATCATTCGTCTTCCTGCACTACATGTTCAAGAGGAAATAAGGGAGAGCTGGGTTACAAAACGTAAATGTAACTATTATGTCTACAAAGCTATCATGTCAGCAGATCCAATATTAAATGCAAAGGATTGCATTGTTACGGTCATATATGAGGATTGTAATCAATTGGCTTTTATGAGGCCTAGTAAAGACGCGACATGGACCTATGTTAACCCAAACTTGTCTAGGATTCAAGAAATTCTTCTTGTTGATCAAAACAAGTTGTACGCTATTCATAATTGGGATGAGGAGGATTTTCACAAACTTTCAACTTTTGAAATAAGTACTCAGTCTAGCTACACATCCAATCCAAAACTAGTCGAAAACTACATTTTATCAGAAGACGATTATCTCTGGTTCAAGACGTATCTGCTGTATTCTATTGAAAGAGAATTGCTGATGATTTCCAGATATCGCATCTGTACTGGTAAGGGAGGTCCGCCGGACACAAGGAAATTCAAAATTTACAAATTGGATTTTGATAGGTGGGAGTGGATTGAGAAAGAAACCCTAGGTGATATTGCTCTCTTTGTGGGTGATAATTTTCCAATATCTGTGCTGGCTTCAAAGTTTCCAGGATGCATGCCGAATTGTATATACTTCAACCATGATCATGATGAAATCGGTTATGGTACTGATCCTCTTACTGATTTTGGTGTCTATGATGTCGCAAGTCAAGTTGTTTCACAGCCTTACAACACATGTGCGATGACCCTGGTGAAGATGGCCAAAAAACCAACTATTTGGGTTGTACCACCTTTCCAAGCAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko00941 ko00945 ko01100 ko01110 map00940 map00941 map00945 map01100 map01110
Pfam Domains
Protein Families
Transferase

Protein Analysis

345

Amino Acids

40.45

Weight (kDa)

6.12

Isoelectric Point (pI)

42.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Beta-prop_KIB1-4 PF03478 33 - 310 1.1e-43 KIB1-4 beta-propeller
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 309
AccII CGCG 1 cut(s) 419
AciI CCGC 2 cut(s) 129, 704
AclWI GGATC 3 cut(s) 139, 326, 896
AcoI YGGCCR 1 cut(s) 990
AcsI RAATTY 4 cut(s) 61, 462, 719, 726
AcuI CTGAAG 1 cut(s) 120
AfaI GTAC 5 cut(s) 491, 550, 688, 898, 1017
AflIII ACRYGT 2 cut(s) 250, 965
AgsI TTSAA 9 cut(s) 257, 458, 534, 542, 625, 650, 724, 831, 868
AhlI ACTAGT 1 cut(s) 580
AjnI CCWGG 2 cut(s) 838, 978
AluBI AGCT 4 cut(s) 155, 276, 317, 561
AluI AGCT 4 cut(s) 155, 276, 317, 561
AlwI GGATC 3 cut(s) 139, 326, 896
AoxI GGCC 2 cut(s) 404, 990
ApoI RAATTY 4 cut(s) 61, 462, 719, 726
Asp700I GAANNNNTTC 1 cut(s) 465
AspA2I CCTAGG 1 cut(s) 775
AspS9I GGNCC 2 cut(s) 426, 701
AsuHPI GGTGA 3 cut(s) 791, 812, 994
AvaII GGWCC 2 cut(s) 426, 701
AvrII CCTAGG 1 cut(s) 775
BalI TGGCCA 1 cut(s) 992
BbsI GAAGAC 2 cut(s) 230, 612
BccI CCATC 2 cut(s) 138, 982
BciT130I CCWGG 2 cut(s) 840, 980
BclI TGATCA 2 cut(s) 475, 874
BcuI ACTAGT 1 cut(s) 580
BfaI CTAG 6 cut(s) 77, 408, 450, 558, 581, 776
BlnI CCTAGG 1 cut(s) 775
BmcAI AGTACT 1 cut(s) 550
Bme1390I CCNGG 2 cut(s) 840, 980
Bme18I GGWCC 2 cut(s) 426, 701
BmgT120I GGNCC 2 cut(s) 426, 701
BmrFI CCNGG 2 cut(s) 840, 980
BmsI GCATC 2 cut(s) 690, 833
BpiI GAAGAC 2 cut(s) 230, 612
BsaBI GATNNNNATC 1 cut(s) 384
BsaJI CCNNGG 2 cut(s) 775, 978
Bse1I ACTGG 1 cut(s) 694
Bse8I GATNNNNATC 1 cut(s) 384
BseBI CCWGG 2 cut(s) 840, 980
BseDI CCNNGG 2 cut(s) 775, 978
BseGI GGATG 4 cut(s) 149, 514, 566, 848
BseJI GATNNNNATC 1 cut(s) 384
BseMII CTCAG 1 cut(s) 566
BseNI ACTGG 1 cut(s) 694
BseRI GAGGAG 1 cut(s) 527
BseYI CCCAGC 1 cut(s) 276
BsgI GTGCAG 1 cut(s) 228
Bsh1236I CGCG 1 cut(s) 419
BshFI GGCC 2 cut(s) 406, 992
BsiSI CCGG 1 cut(s) 707
BsnI GGCC 2 cut(s) 406, 992
Bsp143I GATC 5 cut(s) 131, 331, 475, 874, 901
BspACI CCGC 2 cut(s) 129, 704
BspANI GGCC 2 cut(s) 406, 992
BspCNI CTCAG 1 cut(s) 565
BspFNI CGCG 1 cut(s) 419
BspHI TCATGA 1 cut(s) 877
BspPI GGATC 3 cut(s) 139, 326, 896
BsrI ACTGG 1 cut(s) 694
BssECI CCNNGG 2 cut(s) 775, 978
BssMI GATC 5 cut(s) 131, 331, 475, 874, 901
BssT1I CCWWGG 1 cut(s) 775
Bst2UI CCWGG 2 cut(s) 840, 980
Bst4CI ACNGT 1 cut(s) 367
Bst6I CTCTTC 1 cut(s) 39
BstC8I GCNNGC 2 cut(s) 825, 848
BstDEI CTNAG 1 cut(s) 552
BstEII GGTNACC 1 cut(s) 175
BstF5I GGATG 4 cut(s) 149, 514, 566, 848
BstFNI CGCG 1 cut(s) 419
BstKTI GATC 5 cut(s) 134, 334, 478, 877, 904
BstMBI GATC 5 cut(s) 131, 331, 475, 874, 901
BstMWI GCNNNNNNNGC 1 cut(s) 118
BstNI CCWGG 2 cut(s) 840, 980
BstNSI RCATGY 3 cut(s) 254, 850, 969
BstPI GGTNACC 1 cut(s) 175
BstSCI CCNGG 2 cut(s) 838, 978
BstUI CGCG 1 cut(s) 419
BstV2I GAAGAC 2 cut(s) 230, 612
BstX2I RGATCY 2 cut(s) 131, 331
BstXI CCANNNNNNTGG 1 cut(s) 1008
BstYI RGATCY 2 cut(s) 131, 331
BsuRI GGCC 2 cut(s) 406, 992
BtgZI GCGATG 1 cut(s) 986
BtsCI GGATG 4 cut(s) 149, 514, 566, 848
Cac8I GCNNGC 2 cut(s) 825, 848
CciI TCATGA 1 cut(s) 877
Cfr13I GGNCC 2 cut(s) 426, 701
CseI GACGC 1 cut(s) 425
Csp6I GTAC 5 cut(s) 490, 549, 687, 897, 1016
CviAII CATG 7 cut(s) 251, 322, 423, 847, 872, 878, 966
CviJI RGCY 9 cut(s) 155, 276, 317, 395, 406, 561, 827, 955, 992
CviKI_1 RGCY 9 cut(s) 155, 276, 317, 395, 406, 561, 827, 955, 992
CviQI GTAC 5 cut(s) 490, 549, 687, 897, 1016
DdeI CTNAG 1 cut(s) 552
DpnI GATC 5 cut(s) 133, 333, 477, 876, 903
DpnII GATC 5 cut(s) 131, 331, 475, 874, 901
EaeI YGGCCR 1 cut(s) 990
Eam1104I CTCTTC 1 cut(s) 39
EarI CTCTTC 1 cut(s) 39
EciI GGCGGA 1 cut(s) 693
Eco130I CCWWGG 1 cut(s) 775
Eco147I AGGCCT 1 cut(s) 406
Eco32I GATATC 1 cut(s) 677
Eco47I GGWCC 2 cut(s) 426, 701
Eco57I CTGAAG 1 cut(s) 120
Eco91I GGTNACC 1 cut(s) 175
EcoO65I GGTNACC 1 cut(s) 175
EcoRII CCWGG 2 cut(s) 838, 978
EcoRV GATATC 1 cut(s) 677
EcoT14I CCWWGG 1 cut(s) 775
EcoT22I ATGCAT 1 cut(s) 848
ErhI CCWWGG 1 cut(s) 775
FaeI CATG 7 cut(s) 254, 325, 426, 850, 875, 881, 969
FalI AAGNNNNNCTT 2 cut(s) 450, 482
FatI CATG 7 cut(s) 250, 321, 422, 846, 871, 877, 965
FbaI TGATCA 2 cut(s) 475, 874
FblI GTMKAC 1 cut(s) 309
FokI GGATG 4 cut(s) 156, 521, 553, 855
FspBI CTAG 6 cut(s) 77, 408, 450, 558, 581, 776
GsaI CCCAGC 1 cut(s) 280
HaeIII GGCC 2 cut(s) 406, 992
HapII CCGG 1 cut(s) 707
HgaI GACGC 1 cut(s) 425
Hin1II CATG 7 cut(s) 254, 325, 426, 850, 875, 881, 969
HincII GTYRAC 1 cut(s) 436
HindII GTYRAC 1 cut(s) 436
HinfI GANTC 2 cut(s) 34, 454
HpaI GTTAAC 1 cut(s) 436
HpaII CCGG 1 cut(s) 707
HphI GGTGA 3 cut(s) 791, 812, 994
Hpy166II GTNNAC 2 cut(s) 310, 436
Hpy188I TCNGA 2 cut(s) 139, 604
Hpy188III TCNNGA 5 cut(s) 257, 458, 625, 672, 878
Hpy8I GTNNAC 2 cut(s) 310, 436
HpyAV CCTTC 1 cut(s) 134
HpyCH4III ACNGT 1 cut(s) 367
HpyCH4IV ACGT 3 cut(s) 72, 289, 629
HpyCH4V TGCA 4 cut(s) 245, 347, 357, 846
HpyF10VI GCNNNNNNNGC 1 cut(s) 118
HpyF3I CTNAG 1 cut(s) 552
HpySE526I ACGT 3 cut(s) 72, 289, 629
Hsp92II CATG 7 cut(s) 254, 325, 426, 850, 875, 881, 969
Ksp22I TGATCA 2 cut(s) 475, 874
KspAI GTTAAC 1 cut(s) 436
Kzo9I GATC 5 cut(s) 131, 331, 475, 874, 901
LweI GCATC 2 cut(s) 690, 833
MaeI CTAG 6 cut(s) 77, 408, 450, 558, 581, 776
MaeII ACGT 3 cut(s) 72, 289, 629
MaeIII GTNAC 4 cut(s) 175, 280, 296, 361
MalI GATC 5 cut(s) 133, 333, 477, 876, 903
MboI GATC 5 cut(s) 131, 331, 475, 874, 901
MboII GAAGA 6 cut(s) 56, 126, 230, 458, 617, 997
MfeI CAATTG 1 cut(s) 389
MflI RGATCY 2 cut(s) 131, 331
MlsI TGGCCA 1 cut(s) 992
MluNI TGGCCA 1 cut(s) 992
MnlI CCTC 9 cut(s) 30, 165, 253, 370, 396, 505, 508, 692, 915
Mox20I TGGCCA 1 cut(s) 992
Mph1103I ATGCAT 1 cut(s) 848
MroXI GAANNNNTTC 1 cut(s) 465
MscI TGGCCA 1 cut(s) 992
MseI TTAA 4 cut(s) 149, 204, 341, 435
MslI CAYNNNNRTG 1 cut(s) 876
Msp20I TGGCCA 1 cut(s) 992
MspI CCGG 1 cut(s) 707
MspR9I CCNGG 2 cut(s) 840, 980
MunI CAATTG 1 cut(s) 389
MvaI CCWGG 2 cut(s) 840, 980
MvnI CGCG 1 cut(s) 419
MwoI GCNNNNNNNGC 1 cut(s) 118
NdeII GATC 5 cut(s) 131, 331, 475, 874, 901
NlaIII CATG 7 cut(s) 254, 325, 426, 850, 875, 881, 969
NsiI ATGCAT 1 cut(s) 848
NspI RCATGY 3 cut(s) 254, 850, 969
PaeI GCATGC 1 cut(s) 850
PagI TCATGA 1 cut(s) 877
PceI AGGCCT 1 cut(s) 406
PciI ACATGT 2 cut(s) 250, 965
PdmI GAANNNNTTC 1 cut(s) 465
PfeI GAWTC 2 cut(s) 34, 454
PfoI TCCNGGA 1 cut(s) 838
PscI ACATGT 2 cut(s) 250, 965
Psp6I CCWGG 2 cut(s) 838, 978
PspEI GGTNACC 1 cut(s) 175
PspFI CCCAGC 1 cut(s) 276
PspGI CCWGG 2 cut(s) 838, 978
PspPI GGNCC 2 cut(s) 426, 701
PsuI RGATCY 2 cut(s) 131, 331
RsaI GTAC 5 cut(s) 491, 550, 688, 898, 1017
RsaNI GTAC 5 cut(s) 490, 549, 687, 897, 1016
RseI CAYNNNNRTG 1 cut(s) 876
SaqAI TTAA 4 cut(s) 149, 204, 341, 435
Sau3AI GATC 5 cut(s) 131, 331, 475, 874, 901
Sau96I GGNCC 2 cut(s) 426, 701
ScaI AGTACT 1 cut(s) 550
ScrFI CCNGG 2 cut(s) 840, 980
SfaNI GCATC 2 cut(s) 690, 833
SinI GGWCC 2 cut(s) 426, 701
SmiMI CAYNNNNRTG 1 cut(s) 876
SpeI ACTAGT 1 cut(s) 580
SphI GCATGC 1 cut(s) 850
SseBI AGGCCT 1 cut(s) 406
SsiI CCGC 2 cut(s) 129, 704
SspI AATATT 1 cut(s) 339
SspMI CTAG 6 cut(s) 77, 408, 450, 558, 581, 776
StuI AGGCCT 1 cut(s) 406
StyD4I CCNGG 2 cut(s) 838, 978
StyI CCWWGG 1 cut(s) 775
TaaI ACNGT 1 cut(s) 367
TaiI ACGT 3 cut(s) 75, 292, 632
TaqI TCGA 1 cut(s) 585
TatI WGTACW 2 cut(s) 548, 686
TfiI GAWTC 2 cut(s) 34, 454
Tru1I TTAA 4 cut(s) 149, 204, 341, 435
Tru9I TTAA 4 cut(s) 149, 204, 341, 435
TspDTI ATGAA 2 cut(s) 488, 897
TspGWI ACGGA 1 cut(s) 185
VpaK11BI GGWCC 2 cut(s) 426, 701
XapI RAATTY 4 cut(s) 61, 462, 719, 726
XceI RCATGY 3 cut(s) 254, 850, 969
XmaJI CCTAGG 1 cut(s) 775
XmiI GTMKAC 1 cut(s) 309
XmnI GAANNNNTTC 1 cut(s) 465
XspI CTAG 6 cut(s) 77, 408, 450, 558, 581, 776
ZrmI AGTACT 1 cut(s) 550
Zsp2I ATGCAT 1 cut(s) 848
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.