Rmu_sc0001673.1_g000036

Transporter

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001673.1
Physical Location & Seq
Forward (+)
203918 .. 211179
7262 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001673.1_g000036.1.cds

Sequence Viewer

Length: 1416 bp
atggggactctggcaccaaactccatagaatcagaagcacactatcgtaatcaagatcaagtagtagatggtaatcatgccaaggttggtcaagatgatgatgaccaacagaaccaactggatgccggtgccaagtttgttcttaaatccaaaggatcatgggtgcactgtggttatcatttgactacttcaatagttgctccacctctgctaagtctaccgtacgctttcacattcctcggatggacgggcggagttatttgtctggtgatcggagcattagtaactttctactcgtacaacttaatctctctggtgctcgagcattatgctcaattgggtcatcgccaacttcgcttcagagacatggctcgtgacattttaggacccaaatggggtcgctatttcgttggtccaattcagtttatggtatgctatggtgctgttgtggcttgtactcttttgggagggcaatgcatgaaggcagtttacatgctgacaaacacaaatgggagcatgaagctgtatgagtttgtgatcatatttggatgcttcatgctgattttggcccaaatcccatcttttcactcactacggcacatcaaccttgtctccatgatcctttgcctagcgtatagtgtttgtgctactgctgcttgcatctatattggaaattcttcaaaaggaccacccaaggactattctttgaagggcaacaccgagaatcagatttttgggatatttaatgccaatgccatcattgctacgacatacggcaatggtatcattccagaaattcaggcaacaatcgcagcaccagtgaagggaaagatgttcaagggattgtgtgtttgttacacaatagtcacaatgactttcttcagcgttgcgatatctggctattgggcatttggtaaccaatctgaaggcctcatccttagcaacttcttgtccgatggcaaccctttggtgccgaagtggttcattttcatgacgaacattttcaccatattccagctttccgctgttggtgtggtttatctgcagcccacaaatgaagtactagagagagcatttgcagacccaacaaggaaagaattttcagctcgaaatgtgatcccaagggtgatctctcggtcactatctgtcatcacagcaacaaccgtagcagcaatgcttccattttttggggacatcaatgcagttattggggcttttggtttcatgcccctcgacttcatcttgcctgttgtcttcttcaacttgacctttaagccatcaaaacgaagccttgttttctggttgaacaccaccattgctgtggttttttcagtcatgggggttttagcagcgattgcagctgtaagacaaattagcctggatgccagttcttacaagttatttgcgaatttatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

471

Amino Acids

51.69

Weight (kDa)

8.76

Isoelectric Point (pI)

30.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000597)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G08230 AT1G08230 AT1G08230 AT1G08230 AT1G08230
fragaria_vesca FvH4_3g30140 FvH4_7g06340 FvH4_7g06350 FvH4_7g06350
malus_domestica MD02G1244800.v1.1 MD03G1133300.v1.1 MD07G1072100.v1.1 MD07G1072300.v1.1 MD11G1155800.v1.1 MD11G1156000.v1.1
prunus_persica Prupe.2G090300_v2.0.a1 Prupe.2G090500_v2.0.a1 Prupe.6G118000_v2.0.a1 Prupe.6G118000_v2.0.a1 Prupe.6G118000_v2.0.a1
pyrus_communis pycom02g21070 pycom03g08970 pycom07g05520
rosa_chinensis RchiOBHm_Chr1g0334311 RchiOBHm_Chr1g0334341 RchiOBHm_Chr1g0334351 RchiOBHm_Chr1g0334371 RchiOBHm_Chr1g0334381 RchiOBHm_Chr1g0334431 RchiOBHm_Chr5g0055491 RchiOBHm_Chr5g0055511
rosa_laevigata RLG00000029454 RLG00000029457 RLG00000029458 RLG00000029459 RLG00000029461 RLG00000034991 RLG00000034993
rosa_multiflora Rmu_sc0001673.1_g000036 Rmu_sc0001673.1_g000040 Rmu_sc0016880.1_g000002 Rmu_ssc0000047.1_g000014 Rmu_ssc0000047.1_g000015 Rmu_ssc0000047.1_g000016 Rmu_ssc0000047.1_g000023
rosa_roxburghii Rroxscaffold_1G00024820 Rroxscaffold_1G00024850 Rroxscaffold_1G00024860 Rroxscaffold_4G00316880 Rroxscaffold_4G00316900
rosa_rugosa Rorug01G0113300.1 Rorug01G0113400 Rorug01G0113500 Rorug05G0293200 Rorug05G0293200 Rorug05G0293400.1
rosa_samantha Rh1AG138200 Rh1AG138300 Rh1AG139000 Rh1BG104900 Rh1CG130400 Rh1CG130500 Rh1CG131000 Rh1DG142700 Rh1DG142800 Rh5AG362800 Rh5AG363000 Rh5BG375000 Rh5BG375200 Rh5CG396900 Rh5CG397100 Rh5DG388300 Rh5DG388400
rosa_wichuraiana Rw0G003720 Rw0G003730 Rw0G003740 Rw1G011440 Rw1G011450 Rw5G034150 Rw5G034170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 3 cut(s) 13, 128, 970
AccB7I CCANNNNNTGG 1 cut(s) 1187
AccI GTMKAC 1 cut(s) 217
AciI CCGC 2 cut(s) 252, 1023
AclWI GGATC 3 cut(s) 163, 613, 1111
AcsI RAATTY 4 cut(s) 673, 795, 1097, 1408
AcuI CTGAAG 3 cut(s) 343, 865, 945
AfaI GTAC 4 cut(s) 224, 299, 457, 1062
AfiI CCNNNNNNNGG 3 cut(s) 395, 824, 1187
AgsI TTSAA 6 cut(s) 192, 681, 709, 838, 1261, 1306
AjnI CCWGG 1 cut(s) 1377
AluBI AGCT 4 cut(s) 523, 1018, 1106, 1361
AluI AGCT 4 cut(s) 523, 1018, 1106, 1361
Alw21I GWGCWC 2 cut(s) 168, 321
Alw26I GTCTC 2 cut(s) 357, 616
Alw44I GTGCAC 1 cut(s) 164
AlwI GGATC 3 cut(s) 163, 613, 1111
Ama87I CYCGRG 1 cut(s) 320
AoxI GGCC 2 cut(s) 567, 928
ApaLI GTGCAC 1 cut(s) 164
ApeKI GCWGC 6 cut(s) 653, 812, 1045, 1169, 1349, 1358
ApoI RAATTY 4 cut(s) 673, 795, 1097, 1408
Asp700I GAANNNNTTC 3 cut(s) 676, 980, 1001
AspS9I GGNCC 4 cut(s) 386, 413, 568, 686
AsuHPI GGTGA 3 cut(s) 280, 997, 1138
AvaI CYCGRG 1 cut(s) 320
AvaII GGWCC 3 cut(s) 386, 413, 686
BaeGI GKGCMC 1 cut(s) 168
BanI GGYRCC 3 cut(s) 13, 128, 970
BarI GAAGNNNNNNTAC 2 cut(s) 473, 505
BauI CACGAG 1 cut(s) 372
BbsI GAAGAC 1 cut(s) 1246
Bbv12I GWGCWC 2 cut(s) 168, 321
BbvI GCAGC 6 cut(s) 640, 824, 1057, 1181, 1361, 1370
BccI CCATC 6 cut(s) 62, 237, 586, 764, 950, 1285
BceAI ACGGC 2 cut(s) 611, 790
BcgI CGANNNNNNTGC 2 cut(s) 311, 345
BciT130I CCWGG 1 cut(s) 1379
BclI TGATCA 1 cut(s) 537
BcoDI GTCTC 2 cut(s) 357, 616
BfaI CTAG 2 cut(s) 629, 1064
BfmI CTRYAG 1 cut(s) 1043
BisI GCNGC 6 cut(s) 654, 813, 1046, 1170, 1350, 1359
BlsI GCNGC 6 cut(s) 655, 814, 1047, 1171, 1351, 1360
BmcAI AGTACT 1 cut(s) 1062
Bme1390I CCNGG 1 cut(s) 1379
Bme18I GGWCC 3 cut(s) 386, 413, 686
BmeT110I CYCGRG 1 cut(s) 320
BmgT120I GGNCC 4 cut(s) 386, 413, 568, 686
BmiI GGNNCC 4 cut(s) 15, 130, 388, 972
BmrFI CCNGG 1 cut(s) 1379
BmsI GCATC 4 cut(s) 112, 539, 669, 1372
BpiI GAAGAC 1 cut(s) 1246
Bpu10I CCTNAGC 1 cut(s) 938
BsaBI GATNNNNATC 1 cut(s) 72
BsaJI CCNNGG 4 cut(s) 81, 238, 693, 1121
BsaXI ACNNNNNCTCC 4 cut(s) 267, 297, 596, 626
Bsc4I CCNNNNNNNGG 3 cut(s) 395, 824, 1187
Bse118I RCCGGY 1 cut(s) 125
Bse1I ACTGG 3 cut(s) 123, 818, 1386
Bse3DI GCAATG 5 cut(s) 479, 759, 784, 1179, 1314
Bse8I GATNNNNATC 1 cut(s) 72
BseBI CCWGG 1 cut(s) 1379
BseDI CCNNGG 4 cut(s) 81, 238, 693, 1121
BseGI GGATG 5 cut(s) 127, 248, 554, 933, 1387
BseJI GATNNNNATC 1 cut(s) 72
BseLI CCNNNNNNNGG 3 cut(s) 395, 824, 1187
BseMI GCAATG 5 cut(s) 479, 759, 784, 1179, 1314
BseNI ACTGG 3 cut(s) 123, 818, 1386
BseSI GKGCMC 1 cut(s) 168
BseXI GCAGC 6 cut(s) 640, 824, 1057, 1181, 1361, 1370
BshFI GGCC 2 cut(s) 569, 930
BshNI GGYRCC 3 cut(s) 13, 128, 970
BsiHKAI GWGCWC 2 cut(s) 168, 321
BsiHKCI CYCGRG 1 cut(s) 320
BsiSI CCGG 1 cut(s) 126
BsiWI CGTACG 1 cut(s) 222
BslFI GGGAC 2 cut(s) 19, 1205
BslI CCNNNNNNNGG 3 cut(s) 395, 824, 1187
BsmAI GTCTC 2 cut(s) 357, 616
BsmFI GGGAC 2 cut(s) 19, 1205
BsnI GGCC 2 cut(s) 569, 930
BsoBI CYCGRG 1 cut(s) 320
Bsp1286I GDGCHC 2 cut(s) 168, 321
Bsp143I GATC 7 cut(s) 55, 155, 270, 537, 618, 1116, 1128
BspACI CCGC 2 cut(s) 252, 1023
BspANI GGCC 2 cut(s) 569, 930
BspHI TCATGA 1 cut(s) 990
BspLI GGNNCC 4 cut(s) 15, 130, 388, 972
BspMAI CTGCAG 1 cut(s) 1047
BspPI GGATC 3 cut(s) 163, 613, 1111
BspT107I GGYRCC 3 cut(s) 13, 128, 970
BsrDI GCAATG 5 cut(s) 479, 759, 784, 1179, 1314
BsrFI RCCGGY 1 cut(s) 125
BsrI ACTGG 3 cut(s) 123, 818, 1386
BssAI RCCGGY 1 cut(s) 125
BssECI CCNNGG 4 cut(s) 81, 238, 693, 1121
BssMI GATC 7 cut(s) 55, 155, 270, 537, 618, 1116, 1128
BssSI CACGAG 1 cut(s) 372
BssT1I CCWWGG 3 cut(s) 81, 693, 1121
Bst2BI CACGAG 1 cut(s) 372
Bst2UI CCWGG 1 cut(s) 1379
Bst4CI ACNGT 3 cut(s) 170, 222, 1165
BstAPI GCANNNNNTGC 1 cut(s) 1355
BstC8I GCNNGC 1 cut(s) 658
BstDEI CTNAG 2 cut(s) 212, 938
BstEII GGTNACC 1 cut(s) 914
BstF5I GGATG 5 cut(s) 127, 248, 554, 933, 1387
BstKTI GATC 7 cut(s) 58, 158, 273, 540, 621, 1119, 1131
BstMAI GTCTC 2 cut(s) 357, 616
BstMBI GATC 7 cut(s) 55, 155, 270, 537, 618, 1116, 1128
BstMWI GCNNNNNNNGC 7 cut(s) 354, 449, 653, 761, 809, 1355, 1358
BstNI CCWGG 1 cut(s) 1379
BstNSI RCATGY 1 cut(s) 496
BstPI GGTNACC 1 cut(s) 914
BstSCI CCNGG 1 cut(s) 1377
BstSFI CTRYAG 1 cut(s) 1043
BstSLI GKGCMC 1 cut(s) 168
BstV1I GCAGC 6 cut(s) 640, 824, 1057, 1181, 1361, 1370
BstV2I GAAGAC 1 cut(s) 1246
BstXI CCANNNNNNTGG 1 cut(s) 1321
BsuRI GGCC 2 cut(s) 569, 930
BtgZI GCGATG 1 cut(s) 329
BtsCI GGATG 5 cut(s) 127, 248, 554, 933, 1387
BtsIMutI CAGTG 2 cut(s) 166, 825
Cac8I GCNNGC 1 cut(s) 658
CciI TCATGA 1 cut(s) 990
Cfr10I RCCGGY 1 cut(s) 125
Cfr13I GGNCC 4 cut(s) 386, 413, 568, 686
Csp6I GTAC 4 cut(s) 223, 298, 456, 1061
CviQI GTAC 4 cut(s) 223, 298, 456, 1061
DdeI CTNAG 2 cut(s) 212, 938
DpnI GATC 7 cut(s) 57, 157, 272, 539, 620, 1118, 1130
DpnII GATC 7 cut(s) 55, 155, 270, 537, 618, 1116, 1128
EciI GGCGGA 1 cut(s) 267
Eco130I CCWWGG 3 cut(s) 81, 693, 1121
Eco147I AGGCCT 1 cut(s) 930
Eco32I GATATC 1 cut(s) 894
Eco47I GGWCC 3 cut(s) 386, 413, 686
Eco57I CTGAAG 3 cut(s) 343, 865, 945
Eco88I CYCGRG 1 cut(s) 320
Eco91I GGTNACC 1 cut(s) 914
EcoO109I RGGNCCY 1 cut(s) 386
EcoO65I GGTNACC 1 cut(s) 914
EcoRII CCWGG 1 cut(s) 1377
EcoRV GATATC 1 cut(s) 894
EcoT14I CCWWGG 3 cut(s) 81, 693, 1121
EcoT22I ATGCAT 1 cut(s) 479
ErhI CCWWGG 3 cut(s) 81, 693, 1121
FaqI GGGAC 2 cut(s) 19, 1205
FbaI TGATCA 1 cut(s) 537
FblI GTMKAC 1 cut(s) 217
Fnu4HI GCNGC 6 cut(s) 654, 813, 1046, 1170, 1350, 1359
FokI GGATG 5 cut(s) 134, 255, 561, 920, 1394
Fsp4HI GCNGC 6 cut(s) 654, 813, 1046, 1170, 1350, 1359
FspBI CTAG 2 cut(s) 629, 1064
GluI GCNGC 6 cut(s) 654, 813, 1046, 1170, 1350, 1359
HaeIII GGCC 2 cut(s) 569, 930
HapII CCGG 1 cut(s) 126
HinfI GANTC 3 cut(s) 7, 29, 724
HpaII CCGG 1 cut(s) 126
HphI GGTGA 3 cut(s) 280, 997, 1138
Hpy166II GTNNAC 3 cut(s) 166, 218, 490
Hpy188I TCNGA 7 cut(s) 34, 242, 275, 362, 729, 925, 955
Hpy188III TCNNGA 5 cut(s) 53, 92, 374, 791, 991
Hpy8I GTNNAC 3 cut(s) 166, 218, 490
HpyAV CCTTC 4 cut(s) 475, 703, 817, 920
HpyCH4III ACNGT 3 cut(s) 170, 222, 1165
HpyCH4V TGCA 7 cut(s) 166, 477, 660, 1045, 1079, 1202, 1358
HpyF10VI GCNNNNNNNGC 7 cut(s) 354, 449, 653, 761, 809, 1355, 1358
HpyF3I CTNAG 2 cut(s) 212, 938
Ksp22I TGATCA 1 cut(s) 537
Kzo9I GATC 7 cut(s) 55, 155, 270, 537, 618, 1116, 1128
LmnI GCTCC 3 cut(s) 205, 275, 513
Lsp1109I GCAGC 6 cut(s) 640, 824, 1057, 1181, 1361, 1370
LweI GCATC 4 cut(s) 112, 539, 669, 1372
MaeI CTAG 2 cut(s) 629, 1064
MaeIII GTNAC 6 cut(s) 283, 374, 854, 865, 914, 1137
MalI GATC 7 cut(s) 57, 157, 272, 539, 620, 1118, 1130
MboI GATC 7 cut(s) 55, 155, 270, 537, 618, 1116, 1128
MboII GAAGA 4 cut(s) 669, 871, 1246, 1249
MfeI CAATTG 1 cut(s) 335
MhlI GDGCHC 2 cut(s) 168, 321
MluCI AATT 7 cut(s) 335, 417, 673, 795, 1097, 1371, 1408
MnlI CCTC 5 cut(s) 216, 248, 461, 941, 1241
Mph1103I ATGCAT 1 cut(s) 479
MroXI GAANNNNTTC 3 cut(s) 676, 980, 1001
MseI TTAA 4 cut(s) 144, 305, 744, 1272
MslI CAYNNNNRTG 2 cut(s) 989, 1319
MspA1I CMGCKG 2 cut(s) 1025, 1361
MspI CCGG 1 cut(s) 126
MspR9I CCNGG 1 cut(s) 1379
MunI CAATTG 1 cut(s) 335
MvaI CCWGG 1 cut(s) 1379
MwoI GCNNNNNNNGC 7 cut(s) 354, 449, 653, 761, 809, 1355, 1358
NdeII GATC 7 cut(s) 55, 155, 270, 537, 618, 1116, 1128
NlaIV GGNNCC 4 cut(s) 15, 130, 388, 972
NmuCI GTSAC 3 cut(s) 374, 865, 1137
NsiI ATGCAT 1 cut(s) 479
NspI RCATGY 1 cut(s) 496
PaeR7I CTCGAG 1 cut(s) 320
PagI TCATGA 1 cut(s) 990
PceI AGGCCT 1 cut(s) 930
PdmI GAANNNNTTC 3 cut(s) 676, 980, 1001
PfeI GAWTC 2 cut(s) 29, 724
Pfl23II CGTACG 1 cut(s) 222
PflMI CCANNNNNTGG 1 cut(s) 1187
PkrI GCNGC 6 cut(s) 655, 814, 1047, 1171, 1351, 1360
PpuMI RGGWCCY 1 cut(s) 386
Psp5II RGGWCCY 1 cut(s) 386
Psp6I CCWGG 1 cut(s) 1377
PspEI GGTNACC 1 cut(s) 914
PspGI CCWGG 1 cut(s) 1377
PspLI CGTACG 1 cut(s) 222
PspN4I GGNNCC 4 cut(s) 15, 130, 388, 972
PspPI GGNCC 4 cut(s) 386, 413, 568, 686
PspPPI RGGWCCY 1 cut(s) 386
PspXI VCTCGAGB 1 cut(s) 320
PstI CTGCAG 1 cut(s) 1047
PvuII CAGCTG 1 cut(s) 1361
RsaI GTAC 4 cut(s) 224, 299, 457, 1062
RsaNI GTAC 4 cut(s) 223, 298, 456, 1061
RseI CAYNNNNRTG 2 cut(s) 989, 1319
SaqAI TTAA 4 cut(s) 144, 305, 744, 1272
SatI GCNGC 6 cut(s) 654, 813, 1046, 1170, 1350, 1359
Sau3AI GATC 7 cut(s) 55, 155, 270, 537, 618, 1116, 1128
Sau96I GGNCC 4 cut(s) 386, 413, 568, 686
ScaI AGTACT 1 cut(s) 1062
ScrFI CCNGG 1 cut(s) 1379
SduI GDGCHC 2 cut(s) 168, 321
SetI ASST 8 cut(s) 87, 208, 525, 609, 1020, 1108, 1271, 1363
SfaNI GCATC 4 cut(s) 112, 539, 669, 1372
SfcI CTRYAG 1 cut(s) 1043
Sfr274I CTCGAG 1 cut(s) 320
SinI GGWCC 3 cut(s) 386, 413, 686
SlaI CTCGAG 1 cut(s) 320
SmiMI CAYNNNNRTG 2 cut(s) 989, 1319
SmlI CTYRAG 1 cut(s) 320
SmoI CTYRAG 1 cut(s) 320
Sse9I AATT 7 cut(s) 335, 417, 673, 795, 1097, 1371, 1408
SseBI AGGCCT 1 cut(s) 930
SsiI CCGC 2 cut(s) 252, 1023
SspMI CTAG 2 cut(s) 629, 1064
StuI AGGCCT 1 cut(s) 930
StyD4I CCNGG 1 cut(s) 1377
StyI CCWWGG 3 cut(s) 81, 693, 1121
TaaI ACNGT 3 cut(s) 170, 222, 1165
TaqI TCGA 3 cut(s) 321, 1108, 1233
TaqII GACCGA 1 cut(s) 1125
TasI AATT 7 cut(s) 335, 417, 673, 795, 1097, 1371, 1408
TatI WGTACW 2 cut(s) 455, 1060
TfiI GAWTC 2 cut(s) 29, 724
Tru1I TTAA 4 cut(s) 144, 305, 744, 1272
Tru9I TTAA 4 cut(s) 144, 305, 744, 1272
TscAI CASTG 2 cut(s) 173, 825
TseFI GTSAC 3 cut(s) 374, 865, 1137
TseI GCWGC 6 cut(s) 653, 812, 1045, 1169, 1349, 1358
Tsp45I GTSAC 3 cut(s) 374, 865, 1137
TspDTI ATGAA 8 cut(s) 494, 533, 544, 973, 979, 1071, 1213, 1228
TspRI CASTG 2 cut(s) 173, 825
Van91I CCANNNNNTGG 1 cut(s) 1187
VneI GTGCAC 1 cut(s) 164
VpaK11BI GGWCC 3 cut(s) 386, 413, 686
XapI RAATTY 4 cut(s) 673, 795, 1097, 1408
XceI RCATGY 1 cut(s) 496
XcmI CCANNNNNNNNNTGG 1 cut(s) 1318
XhoI CTCGAG 1 cut(s) 320
XmiI GTMKAC 1 cut(s) 217
XmnI GAANNNNTTC 3 cut(s) 676, 980, 1001
XspI CTAG 2 cut(s) 629, 1064
ZrmI AGTACT 1 cut(s) 1062
Zsp2I ATGCAT 1 cut(s) 479
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.