Rmu_ssc0000047.1_g000023

GABA transporter 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000047.1
OG0000597
Physical Location & Seq
Forward (+)
107524 .. 108222
699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000047.1_g000023.1.cds

Sequence Viewer

Length: 528 bp
atgtctgggtattgggcgtttggcaaccaagctatgggaacagttctttccaattttatgggtgttgatgggaagcttttactccctacctggtttttgctcatgaccaatgtcttcactcttgtgcaagtcttggctgtcacagtggtttacttgcaaccaacaaatgaagtgtttgagaagaaatttgcagacccaaaaatggatcaattttccatccgtaatgttttgccgcgattgattctccggtcgatcactgtcgtggtagctacattttttgctgcgatgttacctttcttcggagatatcatggcattgtttggggcatttggatgcattcctctagatttcattttgccaatgatattctacaatgtggctttcaagccctcaaagcaaagcctcatattttgggttaacacattgatagcaggagtatcgttctttttggttggggtaggggctgtagcatctgttagacagattgttcttgatgctaaaacatatcacctatttgctaacatgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Aa_trans

Protein Analysis

175

Amino Acids

19.51

Weight (kDa)

9.17

Isoelectric Point (pI)

22.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000597)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G08230 AT1G08230 AT1G08230 AT1G08230 AT1G08230
fragaria_vesca FvH4_3g30140 FvH4_7g06340 FvH4_7g06350 FvH4_7g06350
malus_domestica MD02G1244800.v1.1 MD03G1133300.v1.1 MD07G1072100.v1.1 MD07G1072300.v1.1 MD11G1155800.v1.1 MD11G1156000.v1.1
prunus_persica Prupe.2G090300_v2.0.a1 Prupe.2G090500_v2.0.a1 Prupe.6G118000_v2.0.a1 Prupe.6G118000_v2.0.a1 Prupe.6G118000_v2.0.a1
pyrus_communis pycom02g21070 pycom03g08970 pycom07g05520
rosa_chinensis RchiOBHm_Chr1g0334311 RchiOBHm_Chr1g0334341 RchiOBHm_Chr1g0334351 RchiOBHm_Chr1g0334371 RchiOBHm_Chr1g0334381 RchiOBHm_Chr1g0334431 RchiOBHm_Chr5g0055491 RchiOBHm_Chr5g0055511
rosa_laevigata RLG00000029454 RLG00000029457 RLG00000029458 RLG00000029459 RLG00000029461 RLG00000034991 RLG00000034993
rosa_multiflora Rmu_sc0001673.1_g000036 Rmu_sc0001673.1_g000040 Rmu_sc0016880.1_g000002 Rmu_ssc0000047.1_g000014 Rmu_ssc0000047.1_g000015 Rmu_ssc0000047.1_g000016 Rmu_ssc0000047.1_g000023
rosa_roxburghii Rroxscaffold_1G00024820 Rroxscaffold_1G00024850 Rroxscaffold_1G00024860 Rroxscaffold_4G00316880 Rroxscaffold_4G00316900
rosa_rugosa Rorug01G0113300.1 Rorug01G0113400 Rorug01G0113500 Rorug05G0293200 Rorug05G0293200 Rorug05G0293400.1
rosa_samantha Rh1AG138200 Rh1AG138300 Rh1AG139000 Rh1BG104900 Rh1CG130400 Rh1CG130500 Rh1CG131000 Rh1DG142700 Rh1DG142800 Rh5AG362800 Rh5AG363000 Rh5BG375000 Rh5BG375200 Rh5CG396900 Rh5CG397100 Rh5DG388300 Rh5DG388400
rosa_wichuraiana Rw0G003720 Rw0G003730 Rw0G003740 Rw1G011440 Rw1G011450 Rw5G034150 Rw5G034170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 34
AccII CGCG 1 cut(s) 235
AciI CCGC 1 cut(s) 233
AclWI GGATC 1 cut(s) 213
AcsI RAATTY 1 cut(s) 185
AfiI CCNNNNNNNGG 3 cut(s) 34, 202, 299
AflIII ACRYGT 1 cut(s) 522
AgsI TTSAA 1 cut(s) 385
AjnI CCWGG 1 cut(s) 89
AleI CACNNNNGTG 2 cut(s) 122, 260
AluBI AGCT 3 cut(s) 32, 76, 269
AluI AGCT 3 cut(s) 32, 76, 269
AlwI GGATC 1 cut(s) 213
ApeKI GCWGC 1 cut(s) 281
ApoI RAATTY 1 cut(s) 185
AsuHPI GGTGA 1 cut(s) 500
BbsI GAAGAC 1 cut(s) 106
BbvI GCAGC 1 cut(s) 268
BccI CCATC 2 cut(s) 62, 224
BcgI CGANNNNNNTGC 2 cut(s) 420, 454
BciT130I CCWGG 1 cut(s) 91
BfaI CTAG 1 cut(s) 344
BfmI CTRYAG 1 cut(s) 465
BisI GCNGC 2 cut(s) 233, 282
BlsI GCNGC 2 cut(s) 234, 283
Bme1390I CCNGG 1 cut(s) 91
BmrFI CCNGG 1 cut(s) 91
BmsI GCATC 3 cut(s) 323, 479, 484
BoxI GACNNNNGTC 1 cut(s) 110
BpiI GAAGAC 1 cut(s) 106
BsaWI WCCGGW 1 cut(s) 246
Bsc4I CCNNNNNNNGG 3 cut(s) 34, 202, 299
BseBI CCWGG 1 cut(s) 91
BseGI GGATG 2 cut(s) 216, 338
BseLI CCNNNNNNNGG 3 cut(s) 34, 202, 299
BseXI GCAGC 1 cut(s) 268
Bsh1236I CGCG 1 cut(s) 235
Bsh1285I CGRYCG 1 cut(s) 251
BsiEI CGRYCG 1 cut(s) 251
BsiSI CCGG 1 cut(s) 247
BslI CCNNNNNNNGG 3 cut(s) 34, 202, 299
BsmI GAATGC 1 cut(s) 336
Bsp143I GATC 2 cut(s) 205, 252
BspACI CCGC 1 cut(s) 233
BspFNI CGCG 1 cut(s) 235
BspHI TCATGA 1 cut(s) 102
BspPI GGATC 1 cut(s) 213
BssMI GATC 2 cut(s) 205, 252
Bst2UI CCWGG 1 cut(s) 91
Bst4CI ACNGT 3 cut(s) 43, 145, 259
BstF5I GGATG 2 cut(s) 216, 338
BstFNI CGCG 1 cut(s) 235
BstKTI GATC 2 cut(s) 208, 255
BstMBI GATC 2 cut(s) 205, 252
BstMCI CGRYCG 1 cut(s) 251
BstMWI GCNNNNNNNGC 1 cut(s) 394
BstNI CCWGG 1 cut(s) 91
BstNSI RCATGY 1 cut(s) 526
BstPAI GACNNNNGTC 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 89
BstSFI CTRYAG 1 cut(s) 465
BstUI CGCG 1 cut(s) 235
BstV1I GCAGC 1 cut(s) 268
BstV2I GAAGAC 1 cut(s) 106
BstXI CCANNNNNNTGG 1 cut(s) 58
BtgZI GCGATG 1 cut(s) 299
BtsCI GGATG 2 cut(s) 216, 338
BtsIMutI CAGTG 2 cut(s) 150, 255
CciI TCATGA 1 cut(s) 102
CsiI ACCWGGT 1 cut(s) 89
CviAII CATG 3 cut(s) 103, 310, 523
CviJI RGCY 8 cut(s) 32, 76, 137, 269, 380, 388, 402, 464
CviKI_1 RGCY 8 cut(s) 32, 76, 137, 269, 380, 388, 402, 464
DpnI GATC 2 cut(s) 207, 254
DpnII GATC 2 cut(s) 205, 252
Eco32I GATATC 1 cut(s) 307
EcoRII CCWGG 1 cut(s) 89
EcoRV GATATC 1 cut(s) 307
EcoT22I ATGCAT 1 cut(s) 338
FaeI CATG 3 cut(s) 106, 313, 526
FaiI YATR 7 cut(s) 35, 59, 104, 311, 407, 505, 524
FatI CATG 3 cut(s) 102, 309, 522
Fnu4HI GCNGC 2 cut(s) 233, 282
FokI GGATG 2 cut(s) 203, 345
Fsp4HI GCNGC 2 cut(s) 233, 282
FspBI CTAG 1 cut(s) 344
GluI GCNGC 2 cut(s) 233, 282
HapII CCGG 1 cut(s) 247
Hin1II CATG 3 cut(s) 106, 313, 526
HincII GTYRAC 1 cut(s) 418
HindII GTYRAC 1 cut(s) 418
HindIII AAGCTT 1 cut(s) 74
HinfI GANTC 1 cut(s) 241
HpaI GTTAAC 1 cut(s) 418
HpaII CCGG 1 cut(s) 247
HphI GGTGA 1 cut(s) 500
Hpy166II GTNNAC 2 cut(s) 151, 418
Hpy188I TCNGA 1 cut(s) 302
Hpy188III TCNNGA 3 cut(s) 103, 344, 491
Hpy8I GTNNAC 2 cut(s) 151, 418
HpyCH4III ACNGT 3 cut(s) 43, 145, 259
HpyCH4V TGCA 4 cut(s) 127, 157, 191, 336
HpyF10VI GCNNNNNNNGC 1 cut(s) 394
Hsp92II CATG 3 cut(s) 106, 313, 526
KspAI GTTAAC 1 cut(s) 418
Kzo9I GATC 2 cut(s) 205, 252
LpnPI CCDG 4 cut(s) 76, 103, 260, 417
Lsp1109I GCAGC 1 cut(s) 268
LweI GCATC 3 cut(s) 323, 479, 484
MabI ACCWGGT 1 cut(s) 89
MaeI CTAG 1 cut(s) 344
MaeIII GTNAC 2 cut(s) 139, 288
MalI GATC 2 cut(s) 207, 254
MboI GATC 2 cut(s) 205, 252
MboII GAAGA 3 cut(s) 106, 193, 289
MluCI AATT 3 cut(s) 52, 185, 209
MnlI CCTC 3 cut(s) 351, 400, 413
Mph1103I ATGCAT 1 cut(s) 338
MseI TTAA 1 cut(s) 417
MslI CAYNNNNRTG 3 cut(s) 122, 260, 331
MspI CCGG 1 cut(s) 247
MspR9I CCNGG 1 cut(s) 91
Mva1269I GAATGC 1 cut(s) 336
MvaI CCWGG 1 cut(s) 91
MvnI CGCG 1 cut(s) 235
MwoI GCNNNNNNNGC 1 cut(s) 394
NdeII GATC 2 cut(s) 205, 252
NlaIII CATG 3 cut(s) 106, 313, 526
NmuCI GTSAC 1 cut(s) 139
NsiI ATGCAT 1 cut(s) 338
NspI RCATGY 1 cut(s) 526
OliI CACNNNNGTG 2 cut(s) 122, 260
PagI TCATGA 1 cut(s) 102
PciI ACATGT 1 cut(s) 522
PctI GAATGC 1 cut(s) 336
PfeI GAWTC 1 cut(s) 241
PflMI CCANNNNNTGG 1 cut(s) 34
PkrI GCNGC 2 cut(s) 234, 283
PscI ACATGT 1 cut(s) 522
PshAI GACNNNNGTC 1 cut(s) 110
Psp6I CCWGG 1 cut(s) 89
PspGI CCWGG 1 cut(s) 89
RseI CAYNNNNRTG 3 cut(s) 122, 260, 331
SaqAI TTAA 1 cut(s) 417
SatI GCNGC 2 cut(s) 233, 282
Sau3AI GATC 2 cut(s) 205, 252
ScrFI CCNGG 1 cut(s) 91
SetI ASST 6 cut(s) 34, 78, 92, 271, 295, 513
SexAI ACCWGGT 1 cut(s) 89
SfaNI GCATC 3 cut(s) 323, 479, 484
SfcI CTRYAG 1 cut(s) 465
SmiMI CAYNNNNRTG 3 cut(s) 122, 260, 331
Sse9I AATT 3 cut(s) 52, 185, 209
SsiI CCGC 1 cut(s) 233
SspMI CTAG 1 cut(s) 344
StyD4I CCNGG 1 cut(s) 89
TaaI ACNGT 3 cut(s) 43, 145, 259
TaqI TCGA 1 cut(s) 251
TasI AATT 3 cut(s) 52, 185, 209
TauI GCSGC 1 cut(s) 235
TfiI GAWTC 1 cut(s) 241
Tru1I TTAA 1 cut(s) 417
Tru9I TTAA 1 cut(s) 417
TscAI CASTG 2 cut(s) 150, 262
TseFI GTSAC 1 cut(s) 139
TseI GCWGC 1 cut(s) 281
Tsp45I GTSAC 1 cut(s) 139
TspDTI ATGAA 2 cut(s) 183, 340
TspGWI ACGGA 1 cut(s) 209
TspRI CASTG 2 cut(s) 150, 262
Van91I CCANNNNNTGG 1 cut(s) 34
XapI RAATTY 1 cut(s) 185
XbaI TCTAGA 1 cut(s) 343
XceI RCATGY 1 cut(s) 526
XspI CTAG 1 cut(s) 344
Zsp2I ATGCAT 1 cut(s) 338
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.