Rh2CG330800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0002162
Physical Location & Seq
Forward (+)
43266802 .. 43267101
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG330800.1

Sequence Viewer

Length: 300 bp
ATGATGACAGCGGAAACTGGTCGTGGTCTTCTACTCGTGACGACGACAATGTTCATGAGTGCTGGGACATGTTCTGGTATGTGTCGATTGGGTTTGGAGGGAGTTGTGGCTCTAGTTCCGAAGGTAGGTTTGGTGTTGATCACGACGTTCGAGGTGACGGCTGCCGAGGCGACCAAGTTGGCAATAACTCTTCTAGGGTTTGAGTTGAATCGTTGTCTTGGGCCTGGGTCTGGTCTTGGGTGGGAGTCCCTGTTTGGGTTTCTCATTTCTGGGCTTGGTGGGCCTGTCGGGCTTGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

10.09

Weight (kDa)

5.15

Isoelectric Point (pI)

17.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 11
AfiI CCNNNNNNNGG 3 cut(s) 125, 230, 255
AflIII ACRYGT 1 cut(s) 68
AgsI TTSAA 1 cut(s) 208
AjnI CCWGG 1 cut(s) 223
AjuI GAANNNNNNNTTGG 2 cut(s) 113, 145
AoxI GGCC 2 cut(s) 221, 281
ApeKI GCWGC 1 cut(s) 161
AspS9I GGNCC 2 cut(s) 221, 281
AsuHPI GGTGA 1 cut(s) 166
BauI CACGAG 1 cut(s) 35
BbsI GAAGAC 1 cut(s) 20
BbvI GCAGC 1 cut(s) 148
BceAI ACGGC 1 cut(s) 174
BciT130I CCWGG 1 cut(s) 225
BclI TGATCA 1 cut(s) 138
BfaI CTAG 2 cut(s) 113, 194
BglI GCCNNNNNGGC 1 cut(s) 289
BisI GCNGC 1 cut(s) 162
BlsI GCNGC 1 cut(s) 163
Bme1390I CCNGG 1 cut(s) 225
BmgT120I GGNCC 2 cut(s) 221, 281
BmrFI CCNGG 1 cut(s) 225
BpiI GAAGAC 1 cut(s) 20
BsaJI CCNNGG 2 cut(s) 165, 224
BsaXI ACNNNNNCTCC 2 cut(s) 236, 266
Bsc4I CCNNNNNNNGG 3 cut(s) 125, 230, 255
Bse1I ACTGG 1 cut(s) 22
BseBI CCWGG 1 cut(s) 225
BseDI CCNNGG 2 cut(s) 165, 224
BseLI CCNNNNNNNGG 3 cut(s) 125, 230, 255
BseNI ACTGG 1 cut(s) 22
BseXI GCAGC 1 cut(s) 148
BseYI CCCAGC 1 cut(s) 62
BshFI GGCC 2 cut(s) 223, 283
BslFI GGGAC 2 cut(s) 79, 232
BslI CCNNNNNNNGG 3 cut(s) 125, 230, 255
BsmFI GGGAC 2 cut(s) 79, 232
BsnI GGCC 2 cut(s) 223, 283
Bsp143I GATC 1 cut(s) 138
BspACI CCGC 1 cut(s) 11
BspANI GGCC 2 cut(s) 223, 283
BspHI TCATGA 1 cut(s) 54
BsrI ACTGG 1 cut(s) 22
BssECI CCNNGG 2 cut(s) 165, 224
BssMI GATC 1 cut(s) 138
BssSI CACGAG 1 cut(s) 35
Bst2BI CACGAG 1 cut(s) 35
Bst2UI CCWGG 1 cut(s) 225
Bst6I CTCTTC 1 cut(s) 195
BstKTI GATC 1 cut(s) 141
BstMBI GATC 1 cut(s) 138
BstMWI GCNNNNNNNGC 3 cut(s) 167, 280, 289
BstNI CCWGG 1 cut(s) 225
BstNSI RCATGY 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 223
BstV1I GCAGC 1 cut(s) 148
BstV2I GAAGAC 1 cut(s) 20
BsuRI GGCC 2 cut(s) 223, 283
CciI TCATGA 1 cut(s) 54
Cfr13I GGNCC 2 cut(s) 221, 281
CviAII CATG 2 cut(s) 55, 69
CviJI RGCY 6 cut(s) 110, 161, 223, 274, 283, 292
CviKI_1 RGCY 6 cut(s) 110, 161, 223, 274, 283, 292
DpnI GATC 1 cut(s) 140
DpnII GATC 1 cut(s) 138
Eam1104I CTCTTC 1 cut(s) 195
EarI CTCTTC 1 cut(s) 195
EcoRII CCWGG 1 cut(s) 223
FaeI CATG 2 cut(s) 58, 72
FaiI YATR 3 cut(s) 56, 70, 80
FaqI GGGAC 2 cut(s) 79, 232
FatI CATG 2 cut(s) 54, 68
FbaI TGATCA 1 cut(s) 138
Fnu4HI GCNGC 1 cut(s) 162
Fsp4HI GCNGC 1 cut(s) 162
FspBI CTAG 2 cut(s) 113, 194
GluI GCNGC 1 cut(s) 162
GsaI CCCAGC 1 cut(s) 66
HaeIII GGCC 2 cut(s) 223, 283
Hin1II CATG 2 cut(s) 58, 72
HinfI GANTC 2 cut(s) 208, 245
HphI GGTGA 1 cut(s) 166
Hpy188I TCNGA 1 cut(s) 120
Hpy188III TCNNGA 3 cut(s) 37, 55, 142
Hpy99I CGWCG 2 cut(s) 46, 148
HpyAV CCTTC 1 cut(s) 115
HpyCH4IV ACGT 1 cut(s) 146
HpyF10VI GCNNNNNNNGC 3 cut(s) 167, 280, 289
HpySE526I ACGT 1 cut(s) 146
Hsp92II CATG 2 cut(s) 58, 72
Ksp22I TGATCA 1 cut(s) 138
Kzo9I GATC 1 cut(s) 138
LpnPI CCDG 8 cut(s) 3, 48, 60, 210, 216, 237, 255, 263
Lsp1109I GCAGC 1 cut(s) 148
MaeI CTAG 2 cut(s) 113, 194
MaeII ACGT 1 cut(s) 146
MaeIII GTNAC 2 cut(s) 37, 154
MalI GATC 1 cut(s) 140
MboI GATC 1 cut(s) 138
MboII GAAGA 2 cut(s) 20, 182
MlyI GAGTC 1 cut(s) 254
MnlI CCTC 3 cut(s) 91, 145, 160
MseI TTAA 1 cut(s) 298
MspA1I CMGCKG 1 cut(s) 11
MspR9I CCNGG 1 cut(s) 225
MvaI CCWGG 1 cut(s) 225
MwoI GCNNNNNNNGC 3 cut(s) 167, 280, 289
NdeII GATC 1 cut(s) 138
NlaIII CATG 2 cut(s) 58, 72
NmeAIII GCCGAG 1 cut(s) 190
NmuCI GTSAC 2 cut(s) 37, 154
NspI RCATGY 1 cut(s) 72
PagI TCATGA 1 cut(s) 54
PciI ACATGT 1 cut(s) 68
PfeI GAWTC 1 cut(s) 208
PkrI GCNGC 1 cut(s) 163
PleI GAGTC 1 cut(s) 253
PpsI GAGTC 1 cut(s) 253
PscI ACATGT 1 cut(s) 68
Psp6I CCWGG 1 cut(s) 223
PspFI CCCAGC 1 cut(s) 62
PspGI CCWGG 1 cut(s) 223
PspPI GGNCC 2 cut(s) 221, 281
SaqAI TTAA 1 cut(s) 298
SatI GCNGC 1 cut(s) 162
Sau3AI GATC 1 cut(s) 138
Sau96I GGNCC 2 cut(s) 221, 281
SchI GAGTC 1 cut(s) 254
ScrFI CCNGG 1 cut(s) 225
SetI ASST 4 cut(s) 126, 130, 149, 156
SsiI CCGC 1 cut(s) 11
SspMI CTAG 2 cut(s) 113, 194
StyD4I CCNGG 1 cut(s) 223
TaiI ACGT 1 cut(s) 149
TaqI TCGA 2 cut(s) 85, 150
TfiI GAWTC 1 cut(s) 208
Tru1I TTAA 1 cut(s) 298
Tru9I TTAA 1 cut(s) 298
TseFI GTSAC 2 cut(s) 37, 154
TseI GCWGC 1 cut(s) 161
Tsp45I GTSAC 2 cut(s) 37, 154
TspDTI ATGAA 1 cut(s) 43
XceI RCATGY 1 cut(s) 72
XspI CTAG 2 cut(s) 113, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.