Rh4CG147800

CDPK-related kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
32529673 .. 32573649
43977 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG147800.1

Sequence Viewer

Length: 228 bp
ATGATGACAACAACAATAGCTATTGAAGATGTCCGCAGAGAGGTAAAAATACTGAAAGCATTATCTGGACATAAGAATCTGGTCAGATTTTATGATGCATTTGAGGATGCCAATAATGTCTACATAGTCATGGAGTTGTGTGAAGGTGGAGAACTACTGGATAAAATTTTGTCCAGGGGTGGAAGATACACAGAAGAAGATGCTAAAGTTATTGTTGTGCAAATTTGA

Protein Analysis

75

Amino Acids

8.53

Weight (kDa)

5.04

Isoelectric Point (pI)

45.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 7 - 75 4.9e-09 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 9 - 75 6.7e-15 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 120
AciI CCGC 1 cut(s) 34
AcsI RAATTY 2 cut(s) 165, 222
AfiI CCNNNNNNNGG 1 cut(s) 40
AgsI TTSAA 1 cut(s) 26
AjnI CCWGG 1 cut(s) 173
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
ApoI RAATTY 2 cut(s) 165, 222
BciT130I CCWGG 1 cut(s) 175
Bme1390I CCNGG 1 cut(s) 175
BmrFI CCNGG 1 cut(s) 175
BmsI GCATC 3 cut(s) 85, 97, 190
BsaJI CCNNGG 1 cut(s) 174
Bsc4I CCNNNNNNNGG 1 cut(s) 40
Bse1I ACTGG 1 cut(s) 162
BseBI CCWGG 1 cut(s) 175
BseDI CCNNGG 1 cut(s) 174
BseGI GGATG 1 cut(s) 112
BseLI CCNNNNNNNGG 1 cut(s) 40
BseNI ACTGG 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 40
BspACI CCGC 1 cut(s) 34
BsrI ACTGG 1 cut(s) 162
BssECI CCNNGG 1 cut(s) 174
Bst2UI CCWGG 1 cut(s) 175
BstF5I GGATG 1 cut(s) 112
BstNI CCWGG 1 cut(s) 175
BstSCI CCNGG 1 cut(s) 173
BtsCI GGATG 1 cut(s) 112
CviAII CATG 1 cut(s) 130
CviJI RGCY 1 cut(s) 20
CviKI_1 RGCY 1 cut(s) 20
EcoRII CCWGG 1 cut(s) 173
EcoT22I ATGCAT 1 cut(s) 100
FaeI CATG 1 cut(s) 133
FaiI YATR 4 cut(s) 72, 93, 125, 131
FatI CATG 1 cut(s) 129
FblI GTMKAC 1 cut(s) 120
FokI GGATG 1 cut(s) 119
Hin1II CATG 1 cut(s) 133
HinfI GANTC 1 cut(s) 76
Hpy166II GTNNAC 1 cut(s) 121
Hpy188I TCNGA 1 cut(s) 86
Hpy188III TCNNGA 1 cut(s) 66
Hpy8I GTNNAC 1 cut(s) 121
HpyAV CCTTC 1 cut(s) 137
HpyCH4V TGCA 2 cut(s) 98, 220
Hsp92II CATG 1 cut(s) 133
LpnPI CCDG 5 cut(s) 51, 65, 143, 160, 187
LweI GCATC 3 cut(s) 85, 97, 190
MboII GAAGA 4 cut(s) 38, 195, 206, 209
MluCI AATT 2 cut(s) 165, 222
MnlI CCTC 2 cut(s) 34, 97
Mph1103I ATGCAT 1 cut(s) 100
MslI CAYNNNNRTG 1 cut(s) 128
MspR9I CCNGG 1 cut(s) 175
MvaI CCWGG 1 cut(s) 175
NlaIII CATG 1 cut(s) 133
NsiI ATGCAT 1 cut(s) 100
PfeI GAWTC 1 cut(s) 76
Psp6I CCWGG 1 cut(s) 173
PspGI CCWGG 1 cut(s) 173
RseI CAYNNNNRTG 1 cut(s) 128
ScrFI CCNGG 1 cut(s) 175
SetI ASST 3 cut(s) 22, 45, 148
SfaNI GCATC 3 cut(s) 85, 97, 190
SgeI CNNG 6 cut(s) 78, 92, 142, 170, 186, 187
SmiMI CAYNNNNRTG 1 cut(s) 128
Sse9I AATT 2 cut(s) 165, 222
SsiI CCGC 1 cut(s) 34
StyD4I CCNGG 1 cut(s) 173
TasI AATT 2 cut(s) 165, 222
TfiI GAWTC 1 cut(s) 76
XapI RAATTY 2 cut(s) 165, 222
XmiI GTMKAC 1 cut(s) 120
Zsp2I ATGCAT 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.