Rh6CG169600

CDPK-related kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
23152818 .. 23175400
22583 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG169600.1

Sequence Viewer

Length: 189 bp
ATGCTGGGTGGAAGATACACAGAAGAAGATGCTAAAGTTATTGTTGTGCAAATTTTAAGTGTTATTGCCTATTGTCATCTTCAAGGTGTTGTGGATCGTGATCTAAAGCCAGAGTGGTACACAGATGAAATGGTTTCACAAATTGTTGTTGGTGCAGTTGTTGCAGGTGATTATAGAATTTGTGCTTAA

Protein Analysis

62

Amino Acids

6.89

Weight (kDa)

4.56

Isoelectric Point (pI)

20.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 5 - 38 1e-06 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 155
Acc36I ACCTGC 1 cut(s) 155
AclWI GGATC 1 cut(s) 102
AcsI RAATTY 2 cut(s) 51, 177
AfaI GTAC 1 cut(s) 119
AgsI TTSAA 1 cut(s) 83
AlwI GGATC 1 cut(s) 102
ApoI RAATTY 2 cut(s) 51, 177
AsuHPI GGTGA 1 cut(s) 179
BfuAI ACCTGC 1 cut(s) 155
BmsI GCATC 1 cut(s) 19
BsaBI GATNNNNATC 1 cut(s) 99
Bse8I GATNNNNATC 1 cut(s) 99
BseJI GATNNNNATC 1 cut(s) 99
BseYI CCCAGC 1 cut(s) 4
BsgI GTGCAG 1 cut(s) 174
Bsp143I GATC 2 cut(s) 94, 100
BspMI ACCTGC 1 cut(s) 155
BspPI GGATC 1 cut(s) 102
BssMI GATC 2 cut(s) 94, 100
BstAPI GCANNNNNTGC 1 cut(s) 161
BstKTI GATC 2 cut(s) 97, 103
BstMBI GATC 2 cut(s) 94, 100
BstMWI GCNNNNNNNGC 1 cut(s) 161
BveI ACCTGC 1 cut(s) 155
Csp6I GTAC 1 cut(s) 118
CviJI RGCY 1 cut(s) 109
CviKI_1 RGCY 1 cut(s) 109
CviQI GTAC 1 cut(s) 118
DpnI GATC 2 cut(s) 96, 102
DpnII GATC 2 cut(s) 94, 100
FaiI YATR 1 cut(s) 174
FspEI CC 8 cut(s) 69, 77, 82, 100, 116, 123, 135, 150
GsaI CCCAGC 1 cut(s) 8
HphI GGTGA 1 cut(s) 179
Hpy166II GTNNAC 1 cut(s) 120
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 1 cut(s) 120
HpyCH4V TGCA 3 cut(s) 49, 155, 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 161
Kzo9I GATC 2 cut(s) 94, 100
LpnPI CCDG 2 cut(s) 123, 150
LweI GCATC 1 cut(s) 19
MalI GATC 2 cut(s) 96, 102
MboI GATC 2 cut(s) 94, 100
MboII GAAGA 4 cut(s) 24, 35, 38, 71
MluCI AATT 3 cut(s) 51, 141, 177
MseI TTAA 2 cut(s) 56, 187
MwoI GCNNNNNNNGC 1 cut(s) 161
NdeII GATC 2 cut(s) 94, 100
PaqCI CACCTGC 1 cut(s) 155
PspFI CCCAGC 1 cut(s) 4
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
SaqAI TTAA 2 cut(s) 56, 187
Sau3AI GATC 2 cut(s) 94, 100
SetI ASST 2 cut(s) 88, 169
SfaNI GCATC 1 cut(s) 19
SgeI CNNG 5 cut(s) 17, 95, 110, 122, 177
Sse9I AATT 3 cut(s) 51, 141, 177
TasI AATT 3 cut(s) 51, 141, 177
Tru1I TTAA 2 cut(s) 56, 187
Tru9I TTAA 2 cut(s) 56, 187
TspDTI ATGAA 1 cut(s) 141
XapI RAATTY 2 cut(s) 51, 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.