Rh6DG161600

CDPK-related kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
24262159 .. 24278910
16752 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG161600.1

Sequence Viewer

Length: 195 bp
ATGGAGTACGTGGGTGGAAGATACACAGAAGAAGATGCTAAAGTTATTGTTGTGCAAATTTTAAGTGTTATTGCCTATTGTCATCTTCAAGGTGTTGTGGATCGTGATCTAAAGCCAGAGTGGTACACAGATGAAATGGTTTCACAAATTGTTGTTGGTGCAGTTGTTGCAGGTGATTATAGAATTTGTGCTTAA

Protein Analysis

64

Amino Acids

7.17

Weight (kDa)

4.45

Isoelectric Point (pI)

18.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 6 - 40 9.4e-07 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 161
Acc36I ACCTGC 1 cut(s) 161
AclWI GGATC 1 cut(s) 108
AcsI RAATTY 2 cut(s) 57, 183
AfaI GTAC 2 cut(s) 8, 125
AgsI TTSAA 1 cut(s) 89
AlwI GGATC 1 cut(s) 108
ApoI RAATTY 2 cut(s) 57, 183
AsuHPI GGTGA 1 cut(s) 185
BfuAI ACCTGC 1 cut(s) 161
BmsI GCATC 1 cut(s) 25
BsaAI YACGTR 1 cut(s) 10
BsaBI GATNNNNATC 1 cut(s) 105
Bse8I GATNNNNATC 1 cut(s) 105
BseJI GATNNNNATC 1 cut(s) 105
BsgI GTGCAG 1 cut(s) 180
Bsp143I GATC 2 cut(s) 100, 106
BspMI ACCTGC 1 cut(s) 161
BspPI GGATC 1 cut(s) 108
BssMI GATC 2 cut(s) 100, 106
BstAPI GCANNNNNTGC 1 cut(s) 167
BstBAI YACGTR 1 cut(s) 10
BstKTI GATC 2 cut(s) 103, 109
BstMBI GATC 2 cut(s) 100, 106
BstMWI GCNNNNNNNGC 1 cut(s) 167
BveI ACCTGC 1 cut(s) 161
Csp6I GTAC 2 cut(s) 7, 124
CviJI RGCY 1 cut(s) 115
CviKI_1 RGCY 1 cut(s) 115
CviQI GTAC 2 cut(s) 7, 124
DpnI GATC 2 cut(s) 102, 108
DpnII GATC 2 cut(s) 100, 106
FaiI YATR 1 cut(s) 180
FspEI CC 8 cut(s) 75, 83, 88, 106, 122, 129, 141, 156
HphI GGTGA 1 cut(s) 185
Hpy166II GTNNAC 1 cut(s) 126
Hpy188III TCNNGA 1 cut(s) 104
Hpy8I GTNNAC 1 cut(s) 126
HpyCH4IV ACGT 1 cut(s) 9
HpyCH4V TGCA 3 cut(s) 55, 161, 170
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
HpySE526I ACGT 1 cut(s) 9
Kzo9I GATC 2 cut(s) 100, 106
LpnPI CCDG 2 cut(s) 129, 156
LweI GCATC 1 cut(s) 25
MaeII ACGT 1 cut(s) 9
MalI GATC 2 cut(s) 102, 108
MboI GATC 2 cut(s) 100, 106
MboII GAAGA 4 cut(s) 30, 41, 44, 77
MluCI AATT 3 cut(s) 57, 147, 183
MseI TTAA 2 cut(s) 62, 193
MwoI GCNNNNNNNGC 1 cut(s) 167
NdeII GATC 2 cut(s) 100, 106
PaqCI CACCTGC 1 cut(s) 161
Ppu21I YACGTR 1 cut(s) 10
RsaI GTAC 2 cut(s) 8, 125
RsaNI GTAC 2 cut(s) 7, 124
SaqAI TTAA 2 cut(s) 62, 193
Sau3AI GATC 2 cut(s) 100, 106
SetI ASST 3 cut(s) 12, 94, 175
SfaNI GCATC 1 cut(s) 25
SgeI CNNG 5 cut(s) 22, 101, 116, 128, 183
Sse9I AATT 3 cut(s) 57, 147, 183
TaiI ACGT 1 cut(s) 12
TasI AATT 3 cut(s) 57, 147, 183
Tru1I TTAA 2 cut(s) 62, 193
Tru9I TTAA 2 cut(s) 62, 193
TspDTI ATGAA 1 cut(s) 147
XapI RAATTY 2 cut(s) 57, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.